File: test_index_repeats.h

package info (click to toggle)
seqan2 2.4.0+dfsg-11~bpo9+1
  • links: PTS, VCS
  • area: main
  • in suites: stretch-backports
  • size: 223,500 kB
  • sloc: cpp: 256,886; ansic: 91,672; python: 8,339; sh: 995; xml: 570; makefile: 251; awk: 51
file content (134 lines) | stat: -rw-r--r-- 5,943 bytes parent folder | download | duplicates (3)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
// ==========================================================================
//                 SeqAn - The Library for Sequence Analysis
// ==========================================================================
// Copyright (c) 2006-2018, Knut Reinert, FU Berlin
// All rights reserved.
//
// Redistribution and use in source and binary forms, with or without
// modification, are permitted provided that the following conditions are met:
//
//     * Redistributions of source code must retain the above copyright
//       notice, this list of conditions and the following disclaimer.
//     * Redistributions in binary form must reproduce the above copyright
//       notice, this list of conditions and the following disclaimer in the
//       documentation and/or other materials provided with the distribution.
//     * Neither the name of Knut Reinert or the FU Berlin nor the names of
//       its contributors may be used to endorse or promote products derived
//       from this software without specific prior written permission.
//
// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
// AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
// IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
// ARE DISCLAIMED. IN NO EVENT SHALL KNUT REINERT OR THE FU BERLIN BE LIABLE
// FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
// DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR
// SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER
// CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
// LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
// OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH
// DAMAGE.
//
// ==========================================================================
// Author: Manuel Holtgrewe <manuel.holtgrewe@fu-berlin.de>
// ==========================================================================

// TODO(holtgrew): More tests.

#ifndef SEQAN_TESTS_INDEX_TEST_INDEX_REPEATS_H_
#define SEQAN_TESTS_INDEX_TEST_INDEX_REPEATS_H_

#include <seqan/index.h>

// Repeats with period 1.  Test that all locations of Ns are reported
// although the length might be smaller.

SEQAN_DEFINE_TEST(test_index_repeats_period_1_ignore_minlen_for_ns)
{
    using namespace seqan;

    typedef Repeat<unsigned, unsigned> TRepeat;

    String<TRepeat> repeats;
    Dna5String text = "CCCAGATNCGTGATNNNCCCACA";

    findRepeats(repeats, text, 3);  // TODO(holtgrew): repeat len thresh is 1-off

    SEQAN_ASSERT_EQ(length(repeats), 2u);

    SEQAN_ASSERT_EQ(repeats[0].beginPosition, 7u);
    SEQAN_ASSERT_EQ(repeats[0].endPosition, 8u);
    SEQAN_ASSERT_EQ(repeats[0].period, 1u);

    SEQAN_ASSERT_EQ(repeats[1].beginPosition, 14u);
    SEQAN_ASSERT_EQ(repeats[1].endPosition, 17u);
    SEQAN_ASSERT_EQ(repeats[1].period, 1u);
}

// Repeats with period 1.  Test with many ns such that the field of ns spans over threads.

SEQAN_DEFINE_TEST(test_index_repeats_period_1_many_ns)
{
    using namespace seqan;

    typedef Repeat<unsigned, unsigned> TRepeat;

    String<TRepeat> repeats;
    // The following text has a length of 320 characters such that we can also search for repeats in parallel (condition
    // is length > 2 * minLength * num-threads).  It is written such that one repeat spans the border between two threads
    // for four threads and one thread gets no repeats.
    Dna5String text =
            "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" \
            "NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCGCGCGAAGCGCGCGCGCGCGCGCGCGC" \
            "CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCAAGCGCGCGCGCGCGCGCGCAAGCGCGGCGCGCGCGCGCGCGCGCGC" \
            "CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCCGGCGCGCGCGCGCAAA";

    findRepeats(repeats, text, 2);  // TODO(holtgrew): repeat len thresh is 1-off

    SEQAN_ASSERT_EQ(length(repeats), 2u);

    SEQAN_ASSERT_EQ(repeats[0].beginPosition, 0u);
    SEQAN_ASSERT_EQ(repeats[0].endPosition, 127u);
    SEQAN_ASSERT_EQ(repeats[0].period, 1u);

    SEQAN_ASSERT_EQ(repeats[1].beginPosition, 317u);
    SEQAN_ASSERT_EQ(repeats[1].endPosition, 320u);
    SEQAN_ASSERT_EQ(repeats[1].period, 1u);
}

// Repeats with period 1.  Test case with no Ns, here the repeat
// length is always heeded.

SEQAN_DEFINE_TEST(test_index_repeats_period_1_no_ns)
{
    using namespace seqan;

    typedef Repeat<unsigned, unsigned> TRepeat;

    String<TRepeat> repeats;
    // The following text has a length of 320 characters such that we can also search for repeats in parallel (condition
    // is length > 2 * minLength * num-threads).  It is written such that one repeat spans the border between two threads
    // for four threads and one thread gets no repeats.
    Dna5String text =
            "AAAGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCA" \
            "AACGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGAAGCGCGCGCGCGCGCGCGCGC" \
            "CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCAAGCGCGCGCGCGCGCGCGCAAGCGCGGCGCGCGCGCGCGCGCGCGC" \
            "CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCCGGCGCGCGCGCGCAAA";

    findRepeats(repeats, text, 2);  // TODO(holtgrew): repeat len thresh is 1-off

    SEQAN_ASSERT_EQ(length(repeats), 3u);

    SEQAN_ASSERT_EQ(repeats[0].beginPosition, 0u);
    SEQAN_ASSERT_EQ(repeats[0].endPosition, 3u);
    SEQAN_ASSERT_EQ(repeats[0].period, 1u);

    SEQAN_ASSERT_EQ(repeats[1].beginPosition, 79u);
    SEQAN_ASSERT_EQ(repeats[1].endPosition, 82u);
    SEQAN_ASSERT_EQ(repeats[1].period, 1u);

    SEQAN_ASSERT_EQ(repeats[2].beginPosition, 317u);
    SEQAN_ASSERT_EQ(repeats[2].endPosition, 320u);
    SEQAN_ASSERT_EQ(repeats[2].period, 1u);
}

#endif  // #ifndef SEQAN_TESTS_INDEX_TEST_INDEX_REPEATS_H_