1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87
|
Mason Materializer
Methylation Level Simulator
https://www.seqan.de/apps/mason
Version 2.0.0-beta1
February, 2014
Manuel Holtgrewe
------------------------------------------------------------------------------
Table of Contents
------------------------------------------------------------------------------
1. Overview
2. Examples
3. Reference and Contact
------------------------------------------------------------------------------
1. Overview
------------------------------------------------------------------------------
Mason Materializer takes a reference FASTA file and a VCF variant file and
applies the variants to the reference. The input VCF can contain all variants
that can be generated by the mason_variator program.
This functionality is useful if you want to look at the actual sequence of a
personalized genome, for example, or when applying the variants from a
previously simulated VCF file to put it into an external read simulator.
------------------------------------------------------------------------------
2. Examples
------------------------------------------------------------------------------
You can find the binary "mason_materializer" in the directory "bin" and the
example file in the directory "examples".
------------------------------------------------------------------------------
2.1 Help
------------------------------------------------------------------------------
The command:
$ mason_materializer --help
prints the help for Mason Materializer.
------------------------------------------------------------------------------
2.2 Materializing a VCF file.
------------------------------------------------------------------------------
We take the files adeno_virus.fa and apply the VCF file adeno_virus.vcf to it.
We write the resulting FASTA file to adeno_out.fa
$ adeno_materializer -ir adeno_virus.fa -iv adeno_virus.vcf -o adeno_out.fa
...
$ head adeno_out.fa
>gi|56160436|ref|AC_000005.1|/1
CCTATCTAATAATTTACCTTATACTGGACTAGTGCCAATATTAAAATGAAGTGGGCGTAGTGTGTAATTT
GATTGGGTGGAGGTGTGGCTTTGGCGTGCTTGTAAGTTTGGGCGGATGAGGAAGTGGGGCGCGGCGTGGG
AGCCGGGCGCGCCGGATGTGACGTTTTAGACGCCATTTTACACGGAAATGATGTTTTTTGGGCGTTGTTT
GTGCAAATTTTGTGTTTTAGGCGCGAAAACTGAAATGCGGAAGTGAAAATTGATGACGGCAATTTTATTA
TAGGCGCGGAATATTTACCGAGGGCAGAGTGAACTCTGAGCCTCTACGTGTGGGTTTCGATACGTGAGCG
ACGGGGAAACTCCACGTTGGCGCTCAAAGGGCGCGTTTATTGTTCTGTCAGCTGATCGTTTGGGTATTTA
ATGCCGCCGTGTTCGTCAAGAGGCCACTCTTGAGTGCCAGCGAGAAGAGTTTTCTCTGCCAGCTCATTTT
CACGGCGCCATTATGAGAACTGAAATGACTCCCTTGGTCCTGTCGTATCAGGAAGCTGACGACATATTGG
AGCATTTGGTGGACAACTTTTTTAACGAGGTACCCAGTGATGATGATCTTTATGTTCCGTCTCTTTACGA
$ grep '^>gi' adeno_out.fa
>gi|56160436|ref|AC_000005.1|/1
Note that there is only one haplotype described in the VCF file.
mason_materializer generates a haplotype into the output FASTA file for each
haplotype in the VCF and sequence in the reference file. The name of the
haplotype is the reference name with a suffix consisting of a dash and the
number of the haplotype.
------------------------------------------------------------------------------
3. Reference and Contact
------------------------------------------------------------------------------
In case of questions and problems please contact the mailing list
https://lists.fu-berlin.de/listinfo/seqan-dev
or file a bug at
https://trac.seqan.de/newticket
|