1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508
|
*** RazerS - Fast Read Mapping with Sensitivity Control ***
https://www.seqan.de/apps/razers3.html
---------------------------------------------------------------------------
Table of Contents
---------------------------------------------------------------------------
1. Overview
2. Installation
3. Usage
4. Output Format
5. Example
6. Contact
7. References
---------------------------------------------------------------------------
1. Overview
---------------------------------------------------------------------------
RazerS is a tool for mapping millions of short genomic reads onto a
reference genome. It was designed with focus on mapping next-generation
sequencing reads onto whole DNA genomes. RazerS searches for matches of
reads with a percent identity above a given threshold, whereby it detects
matches with mismatches as well as gaps.
RazerS uses a k-mer index of all reads and counts common k-mers of reads
and the reference genome in parallelograms. Each parallelogram with a k-mer
count above a certain threshold triggers a verification. On success, the
genomic subsequence and the read number are stored and written to the
output file.
---------------------------------------------------------------------------
2. Installation
---------------------------------------------------------------------------
RazerS is distributed with SeqAn - The C++ Sequence Analysis Library (see
https://www.seqan.de). To build RazerS do the following:
1) Download the latest snapshot of SeqAn
2) Unzip it to a directory of your choice (e.g. snapshot)
3) cd snapshot/apps
4) make razers
5) cd razers
6) ./razers --help
Alternatively you can check out the latest Git version of RazerS and SeqAn
with:
1) git clone https://github.com/seqan/seqan.git
2) mkdir seqan/buld; cd seqan/build
3) cmake .. -DCMAKE_BUILD_TYPE=Release
4) make razers
5) ./bin/razers --help
On success, an executable file razers was build and a brief usage
description was dumped.
---------------------------------------------------------------------------
3. Usage
---------------------------------------------------------------------------
To get a short usage description of RazerS, you can execute razers -h or
razers --help.
Usage: razers [OPTION]... <GENOME FILE> <READS FILE>
razers [OPTION]... <GENOME FILE> <MP-READS FILE1> <MP-READS FILE2>
RazerS expects the names of two or three DNA (multi-)Fasta files. The first
contains a reference genome and the second (and third) contains genomic reads
that should be mapped onto the reference. If two read files are given, both
have to contain exactly the same number of reads, which are considered as
mate-pairs. To save memory RazerS uses bit fields which limit the maximal
number of reads to 16.7 mil. and the read length to 256 bps. If your read set
exceeds this limitation please remove "#define RAZERS_MEMOPT" in razers.cpp
and recompile. Without any additional parameters RazerS would map all reads
onto both strands of the reference genome with 92% identity (i.e. 8% errors
per read) and dump all found matches in an output file. The output file name
is the read file name extended by the suffix ".result". The default behaviour
can be modified by adding the following options to the command line:
---------------------------------------------------------------------------
3.1. Main Options
---------------------------------------------------------------------------
[ -f ], [ --forward ]
Only map reads onto the positive/forward strand of the genome. By
default, both strands are scanned.
[ -r ], [ --reverse ]
Only map reads onto the negative/reverse-complement strand of the
genome. By default, both strands are scanned.
[ -i NUM ], [ --percent-identity NUM ]
Set the percent identity threshold. NUM must be a value between 50 and
100 (default is 92). RazerS searches for matches with a percent identity
of at least NUM. A match of a read R with e errors has percent identity
of 100*(1 - e/|R|), whereby |R| is the read length. In other words, a
read is allowed to have not more than |R|*(100-NUM)/100 errors.
[ -rr NUM ], [ --recognition-rate NUM ]
Set the percent recognition rate. NUM must be a value between 80 and 100
(default is 99). The recognition rate controls the sensitivity of RazerS.
The higher the recognition rate the more sensitive is RazerS. The lower
the recognition rate the faster runs RazerS. A value of 100 corresponds
to a lossless read mapping. The recognition rate corresponds to the
expected fraction of matches RazerS will find compared to a lossless
mapping. Depending on the desired recogition rate, the percent identity
and the read length the filter is configured to run as fast as possible.
Therefore it needs access to files with precomputed filtration settings
in a 'gapped_params' subfolder which resides in the razers folder. This
value is ignored if the shape (-s) or the minimum threshold (-t) is set
manually.
[ -id ], [ --indels ]
Consider insertions, deletions and mismatches as errors. By default, only
mismatches are recognized.
[ -ll NUM ], [ --library-length NUM ]
Set the mean library size, default is 220. The library size is the outer
distance of the two reads of a mate-pair. This value is used only for
paired-end read mapping.
[ -le NUM ], [ --library-error NUM ]
Set the tolerated absolute deviation of the library size, default value is
50. This value is used only for paired-end read mapping.
[ -m NUM ], [ --max-hits NUM ]
Output at most NUM of the best matches, default value is 100.
[ --unique ]
Output only unique best matches (like ELAND). This flag corresponds to
'-m 1 -dr 0 -pa'.
[ -tr NUM ], [ --trim-reads NUM ]
Trim reads to length NUM.
[ -o FILE ], [ --output FILE ]
Change the output filename to FILE. By default, this is the read file
name extended by the suffix ".result".
[ -v ], [ --verbose ]
Verbose. Print extra information and running times.
[ -vv ], [ --vverbose ]
Very verbose. Like -v, but also print filtering statistics like true and
false positives (TP/FP).
[ -V ], [ --version ]
Print version information.
[ -h ], [ --help ]
Print a brief usage summary.
---------------------------------------------------------------------------
3.2. Output Format Options
---------------------------------------------------------------------------
[ -a ], [ --alignment ]
Dump the alignment for each match in the ".result" file. The alignment is
written directly after the match and has the following format:
#Read: CAGGAGATAAGCTGGATCGTTTACGGT
#Genome: CAGGAGATAAGC-GGATCTTTTACG--
[ -pa ], [ --purge-ambiguous ]
Omit reads with more than #max-hits many matches.
[ -dr NUM ], [ --distance-range NUM ]
If the best match of a read has E errors, only consider hits with
E <= X <= E+NUM errors as matches.
[ -of NUM ], [ --output-format NUM ]
Select the output format the matches should be stored in. See section 4.
[ -gn NUM ], [ --genome-naming NUM ]
Select how genomes are named in the output file. If NUM is 0, the Fasta
ids of the genome sequences are used (default). If NUM is 1, the genome
sequences are enumerated beginning with 1.
[ -rn NUM ], [ --read-naming NUM ]
Select how reads are named in the output file. If NUM is 0, the Fasta ids
of the reads are used (default). If NUM is 1, the reads are enumerated
beginning with 1. If NUM is 2, the read sequence itself is used.
[ -so NUM ], [ --sort-order NUM ]
Select how matches are ordered in the output file.
If NUM is 0, matches are sorted primarily by the read number and
secondarily by their position in the genome sequence (default).
If NUM is 1, matches are sorted primarily by their position in the genome
sequence and secondarily by the read number.
[ -pf NUM ], [ --position-format NUM ]
Select how positions are stored in the output file.
If NUM is 0, the gap space is used, i.e. gaps around characters are
enumerated beginning with 0 and the beginning and end position is the
postion of the gap before and after a match (default).
If NUM is 1, the position space is used, i.e. characters are enumerated
beginning with 1 and the beginning and end position is the postion of the
first and last character involved in a match.
Example: Consider the string CONCAT. The beginning and end positions
of the substring CAT are (3,6) in gap space and (4,6) in position space.
---------------------------------------------------------------------------
3.3. Filtration Options
---------------------------------------------------------------------------
[ -s BITSTRING ], [ --shape BITSTRING ]
Define the k-mer shape. BITSTRING must be a sequence of bits beginning
and ending with 1, e.g. 1111111001101. A '1' defines a relevant and a
'0' an irrelevant position. Two k-mers are equal, if all characters at
relevant postitions are equal.
[ -t NUM ], [ --threshold NUM ]
Depending on the percent identity and the length, for each read a
threshold of common k-mers between read and reference genome is
calculated. These thresholds determine the filtratition strictness and are
crucial to the overall running time. With this option the threshold values
can manually be raised to a minimum value to reduce the running time at
cost of the mapping sensitivity. All threshold values smaller than NUM
are raised to NUM. The default value is 1.
[ -oc NUM ], [ --overabundance-cut NUM ]
Remove overabundant read k-mers from the k-mer index. k-mers with a
relative abundance above NUM are removed. NUM must be a value between
0 (remove all) and 1 (remove nothing, default).
[ -rl NUM ], [ --repeat-length NUM ]
The repeat length is the minimal length a simple-repeat in the
genome sequence must have to be filtered out by the repeat masker of
RazerS. Simple repeats are tandem repeats of only one repeated
character, e.g. AAAAA. Independently of this parameter, N characters in
the genome are filtered out automatically. Default value is 1000.
[ -tl NUM ], [ --taboo-length NUM ]
The taboo length is the minimal distance two k-mer must have in the
reference genome when counting common k-mers between reads and reference
genome (default is 1).
---------------------------------------------------------------------------
3.4. Verification Options
---------------------------------------------------------------------------
[ -mN ], [ --match-N ]
By default, 'N' characters in read or genome sequences equal to nothing,
not even to another 'N'. They are considered as errors. By activating this
option, 'N' equals to every other character and produces no mismatch in
the verification process. The filtration is not affected by this option.
[ -ed FILE ], [ --error-distr FILE ]
Produce an error distribution file containing the relative frequencies of
mismatches for each read position. If the "--indels" option is given, the
relative frequencies of insertions and deletions are also recorded.
---------------------------------------------------------------------------
4. Output Formats
---------------------------------------------------------------------------
RazerS supports currently 4 different output formats selectable via the
"--output-format NUM" option. The following values for NUM are possible:
0 = Razer Format
1 = Enhanced Fasta Format
2 = Eland Format
3 = General Feature Format (GFF)
---------------------------------------------------------------------------
4.1. Razer Format
---------------------------------------------------------------------------
The output file is a text file whose lines represent matches. A line
consists of different tab separated match values in the following format:
RNAME RBEGIN REND GSTRAND GNAME GBEGIN GEND PERCID [PAIRID PAIRSCR MATEDIST]
Match value description:
RNAME Name of the read sequence (see --read-naming)
RBEGIN Beginning position in the read sequence (0/1 see -pf option)
REND End position in the read sequence (length of the read)
GSTRAND 'F'=forward strand or 'R'=reverse strand
GNAME Name of the genome sequence (see --genome-naming)
GBEGIN Beginning position in the genome sequence
GEND End position in the genome sequence
PERCID Percent identity (see --percent-identity)
For paired-end read mapping 3 additional values are dumped:
PAIRID Unique number to identify the two corresponding mate matches
PAIRSCR The sum of the negative number of errors in both matches
MATEDIST Relative outer distance to the mate match
The absolute value is the insert size
For matches on the reverse strand, GBEGIN and GEND are positions on the
related forward strand. It holds GBEGIN < GEND, regardless of GSTRAND.
---------------------------------------------------------------------------
4.2. Enhanced Fasta Format
---------------------------------------------------------------------------
The matches are stored in the same order as in the Razer format. Each match
is stored in two lines:
>GBEGIN,GEND[KEY1=VALUE1,KEY2=VALUE2,...]
READSEQ
Match value description:
GBEGIN Beginning position in the genome sequence
GEND End position in the genome sequence
READSEQ Read sequence.
The following keys are output:
id ID value of the input file Fasta header (>..[id=ID,..]..)
fragId Fragment ID value (>..[..,fragId=FRAGID,..]..)
contigId Name of the genome sequence (see --genome-naming)
errors Absolute numbers of errors in this match
percId Percent identity (see --percent-identity)
ambiguity Number of matches of this read as good as or better than this
If the ID or fragment ID values of a read couldn't be found in the reads file
the read number (beginning with 0) is used instead. For matches on the
reverse strand, GBegin and GEnd are positions on the related forward strand
and GBEGIN > GEND.
---------------------------------------------------------------------------
4.3. Eland Format
---------------------------------------------------------------------------
Each line of the output file corresponds to a read appearing in the same
order as they are stored in the reads file. A line consists of the following
tab separated values:
>RNAME READSEQ TYPE N0 N1 N2 GNAME GBEGIN* GSTRAND '..' SUBST1 SUBST2 ...
Additional value description:
TYPE NM = No match found
QC = No matching done (too many Ns in read sequence)
Ux = Best match found was unique with x errors
Rx = Multiple best matches found having x errors
N0 N1 N2 Number of exact, 1-error, and 2-error matches
GBEGIN* Minimum of GBEGIN and GEND
SUBSTx Position and type of the x'th mismatch (not for --indels)
(e.g. 12A: 12'th base was A in the genome)
---------------------------------------------------------------------------
4.4. General Feature Format
---------------------------------------------------------------------------
The General Feature Format is specified by the Sanger Institute as a tab-
delimited text format with the following columns:
<seqname> <src> <feat> <start> <end> <score> <strand> <frame> [attr] [cmts]
See also: https://www.sanger.ac.uk/Software/formats/GFF/GFF_Spec.shtml
Consistent with this specification razers GFF output looks as follows:
GNAME razers read GBEGIN GEND PERCID GSTRAND . ATTRIBUTES
Match value description:
GNAME Name of the genome sequence (see --genome-naming)
razers Constant
read Constant
GBEGIN Beginning position in the genome sequence
(positions are counted from 1)
GEND End position in the genome sequence (included!)
PERCID Percent identity (see --percent-identity)
GSTRAND '+'=forward strand or '-'=reverse strand
. Constant
ATTRIBUTES A list of attributes in the format <tag_name>[=<tag>]
separated by ';'
Attributes are:
ID= Name of the read
quality= Ascii coded quality values of the read
cigar= Read-reference alignment description in cigar format*
mutations= Positions and bases that differ from the reference
with respect to the read (counting from 1)
unique This is the best read match and it is unique
multi This is one of multiple best machtes
suboptimal This is a suboptimal read match
The original read sequence can be retrieved using the genomic subsequence
and the information contained in the 'cigar' and 'mutations' tags.
For matches on the reverse strand, GBEGIN and GEND are positions on the
related forward strand. It holds GBEGIN < GEND, regardless of GSTRAND.
*https://may2005.archive.ensembl.org/Docs/wiki/html/EnsemblDocs/CigarFormat.html
---------------------------------------------------------------------------
5. Example
---------------------------------------------------------------------------
---------------------------------------------------------------------------
5.1. Single read mapping
---------------------------------------------------------------------------
There are example read and genome files in the folder in snapshot/apps/
razers/example containing 3 27bp reads and two short contigs. The 3
reads and their reverse-complements were implanted with errors into the
genome. To map the example reads onto the genome do the following:
1) cd snapshot/apps/razers
2) ./razers example/genome.fa example/reads.fa -id -a -mN -v
3) less example/reads.fa.result
On success, RazerS dumped the resulting matches with their corresponding
semi-global alignments into the file example/reads.fa.result:
read1 0 27 F contig1 47 73 92.593
#Read: AATTGAATGAGGTCTTGCAGCCATGGC
#Genome: AATTGAATGACGTC-TGCAGCCATGGC
read1 0 27 R contig2 300 328 92.593
#Read: AATTGAATGAGGTCTT-GCAGCCATGGC
#Genome: AATTGAATGAGGTCTTCGCAGTCATGGC
read2 0 27 R contig2 228 255 96.296
#Read: CAGGAGATAAGCTGGATCGTTTACGGT
#Genome: CAGGAGATAAGCTGGATCGTTTACAGT
read3 0 27 F contig2 335 362 100
#Read: GCCATTAGAGGCCACCACACCAGACGT
#Genome: GCCATTAGAGGCCACCACACCAGNNNN
If alignments are not needed '-a' can be omited resulting in:
read1 0 27 F contig1 47 73 92.593
read1 0 27 R contig2 300 328 92.593
read2 0 27 R contig2 228 255 96.296
read3 0 27 F contig2 335 362 100
---------------------------------------------------------------------------
5.2. Paired-end read mapping
---------------------------------------------------------------------------
To demonstrate how paired-end read mapping works, we provide a read file
with mates of the reads in the example above. To run RazerS in paired-end
mode you simply have to add the second read file to the command line.
1) cd snapshot/apps/razers
2) ./razers example/genome.fa example/reads.fa example/reads2.fa -id -mN
3) less example/reads.fa.result
read1/L 0 27 F contig1 47 73 92.593 1 -3 217
read1/R 0 27 R contig1 236 264 96.296 1 -3 -217
read2/L 0 27 R contig2 228 255 96.296 3 -1 -207
read2/R 0 27 F contig2 48 75 100 3 -1 207
read3/L 0 27 F contig2 335 362 100 2 0 221
read3/R 0 27 R contig2 529 556 100 2 0 -221
In this short example the library sizes vary between 207bp and 221bp. The
default library size of RazerS is 220bp with a tolerance of 50bp, i.e. all
libraries between 170bp and 270bp are recognized. To alter the library size
settings use the -ll and -le options.
The pair score value in the second last column is the negative sum of
errors in both matches and the third last column is a unique number to
identify the two corresponding mate matches. Remember that RazerS can
output more than one match per mate-pair and two corresponding mate matches
are not necessarily in consecutive lines in the output file, e.g. when
altering the sort-order with the -so option.
---------------------------------------------------------------------------
6. Contact
---------------------------------------------------------------------------
For questions or comments, contact:
David Weese <weese@inf.fu-berlin.de>
Anne-Katrin Emde <emde@inf.fu-berlin.de>
---------------------------------------------------------------------------
7. References
---------------------------------------------------------------------------
Weese, D., Emde, A.-K., Rausch, T., Döring, A., & Reinert, K. (2009).
RazerS – Fast read mapping with sensitivity control. Genome Research, 19(9),
1646–1654.
|