1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
|
#include <iostream>
#include <seqan/align.h>
#include <seqan/align_extend.h>
#include <seqan/sequence.h>
using namespace seqan2;
int main()
{
Score<int> sc(2, -1, -2);
Align<Infix<CharString const>::Type> align;
resize(rows(align), 2);
// We create the following initial situation with subject/query and the
// infixes thereof.
//
// infixes/seeds
// <-->
// subject NNNNNNNNNNTTCCGGGACGGTACACACACGGGGGGGGGG
// query CTCGGGACGGTACAGGCACGGTTTTTTTT
CharString subject = "NNNNNNNNNNTTCCGGGACGGTACACACACGGGGGGGGGG";
CharString query = "CTCGGGACGGTACAGGCACGGTTTTTTTT";
assignSource(row(align, 0), infix(subject, 19, 23));
assignSource(row(align, 1), infix(query, 8, 12));
int score = globalAlignment(align, sc);
std::cout << "Initial alignment of infixes (score == " << score << ")\n\n"
<< align;
// The alignment starts at diagonal (23 - 19) = 4. A band of 4 in each direction has
// the following diagonals.
int lDiag = 0, uDiag = 8;
// Set the x-Drop value to 5.
int xDrop = 5;
Tuple<unsigned, 4> positions = { {19u, 8u, 23u, 12u} };
score = extendAlignment(align, score, subject, query, positions, EXTEND_BOTH,
lDiag, uDiag, xDrop, sc);
std::cout << "Resulting alignment (score == " << score << ")\n\n"
<< align;
std::cout << "source(row(align, 0)) == " << source(row(align, 0)) << " (full sequence)\n"
<< "source(row(align, 1)) == " << source(row(align, 1)) << " (full sequence)\n"
<< "\n"
<< "clipping positions of row 0: " << clippedBeginPosition(row(align, 0))
<< ", " << clippedEndPosition(row(align, 0)) << "\n"
<< "clipping positions of row 1: " << clippedBeginPosition(row(align, 1))
<< ", " << clippedEndPosition(row(align, 1)) << "\n";
return 0;
}
|