File: xlate_tables.hh

package info (click to toggle)
tigr-glimmer 3.02b-5
  • links: PTS, VCS
  • area: main
  • in suites: bookworm, bullseye, sid
  • size: 13,948 kB
  • sloc: cpp: 24,416; awk: 232; csh: 220; makefile: 147; sh: 51
file content (156 lines) | stat: -rw-r--r-- 6,358 bytes parent folder | download | duplicates (12)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
//  A. L. Delcher
//
//  File:  xlate_tables.hh
//
//  Last Modified:  Tue May  9 10:25:40 EDT 2006
//
//  DNA to amino-acid translation tables



#ifndef  __XLATE_TABLES_HH_INCLUDED
#define  __XLATE_TABLES_HH_INCLUDED

const bool  IS_AMINO [26] = {
   true,   // A
   false,  // B
   true,   // C
   true,   // D
   true,   // E
   true,   // F
   true,   // G
   true,   // H
   true,   // I
   false,  // J
   true,   // K
   true,   // L
   true,   // M
   true,   // N
   false,  // O
   true,   // P
   true,   // Q
   true,   // R
   true,   // S
   true,   // T
   false,  // U
   true,   // V
   true,   // W
   false,  // X
   true,   // Y
   false   // Z
  };

// The Standard Code
const char  CODON_XLATE_TABLE_1 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Vertebrate Mitochondrial Code
const char  CODON_XLATE_TABLE_2 [] =
  "KNKNTTTT*S*SMIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Yeast Mitochondrial Code
const char  CODON_XLATE_TABLE_3 [] = 
  "KNKNTTTTRSRSMIMIQHQHPPPPRRRRTTTTEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Mold, Protozoan, and Coelenterate Mitochondrial Code
//   and the Mycoplasma/Spiroplasma Code
const char  CODON_XLATE_TABLE_4 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Invertebrate Mitochondrial Code 
const char  CODON_XLATE_TABLE_5 [] = 
  "KNKNTTTTSSSSMIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Ciliate, Dasycladacean and Hexamita Nuclear Code
const char  CODON_XLATE_TABLE_6 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVVQYQYSSSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Echinoderm and Flatworm Mitochondrial Code
const char  CODON_XLATE_TABLE_9 [] = 
  "NNKNTTTTSSSSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Euplotid Nuclear Code
const char  CODON_XLATE_TABLE_10 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSCCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Alternative Yeast Nuclear Code
const char  CODON_XLATE_TABLE_12 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLSLEDEDAAAAGGGGVVVV*Y*YSSSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Ascidian Mitochondrial Code
const char  CODON_XLATE_TABLE_13 [] = 
  "KNKNTTTTGGRSMIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// The Alternative Flatworm Mitochondrial Code
const char  CODON_XLATE_TABLE_14 [] = 
  "NNKNTTTTSSSSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVVYY*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// Blepharisma Nuclear Code
const char  CODON_XLATE_TABLE_15 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*YQYSSSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// Chlorophycean Mitochondrial Code
const char  CODON_XLATE_TABLE_16 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*YLYSSSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// Trematode Mitochondrial Code
const char  CODON_XLATE_TABLE_21 [] = 
  "KNKNTTTTSSSSMIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSSWCWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// Scenedesmus obliquus mitochondrial Code
const char  CODON_XLATE_TABLE_22[] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVVLY*Y*SSS*CWCLFLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

// Thraustochytrium Mitochondrial Code
const char  CODON_XLATE_TABLE_23 [] = 
  "KNKNTTTTRSRSIIMIQHQHPPPPRRRRLLLLEDEDAAAAGGGGVVVV*Y*YSSSS*CWC*FLF";
// aaaaaaaaaaaaaaaaccccccccccccccccggggggggggggggggtttttttttttttttt
// aaaaccccggggttttaaaaccccggggttttaaaaccccggggttttaaaaccccggggtttt
// acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

#endif