File: supertranscripts.fasta

package info (click to toggle)
trinityrnaseq 2.11.0%2Bdfsg-6
  • links: PTS, VCS
  • area: main
  • in suites: bookworm, bullseye, sid
  • size: 417,528 kB
  • sloc: perl: 48,420; cpp: 17,749; java: 12,695; python: 3,124; sh: 1,030; ansic: 983; makefile: 688; xml: 62
file content (426 lines) | stat: -rw-r--r-- 254,266 bytes parent folder | download | duplicates (2)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
>TRINITY_DN138_c0_g1
GGACGTAGTCCGCGATACGTATTCCGCACAGAACCATTATTTTCGAAATAAAATTACACTATTTGCAAAAGTTATTCAATCGTGAGTCTATCCATGAGGAATTGCCAAACCAAACTCAGAATAAATCACTTGACAGCTGTTAAATCGGTCGCCATCTTGAACAGTAATGCCAACTTAGTTATATACCTCGAAAAAAAACACCCGTTATTTAAATTTCTATTTTGAACATGTGGAAAATTTTGCTGTCTAACATTGTATCCATAATCATATTAACTAAGGAAGCTTTATCTTCAG
>TRINITY_DN32_c0_g1
ATCGAACTCACTTTCCATGAAGAACTTCATTAAAAGTTTCTTTCTGCATAAGTCTCTGATTTCGGATTATCGAAGTTCTCCTGATTTCAGAAGTCCTGAGAGAATGATTGTGTCCTGCGTTTATTTGTATTGTTTTTTAATTATGATCGATCAAGGAAAGAAAGTTTTAATTCCTCCCAAATATTCCAACGATTCTCTAAGAAGGACATTCTGCTTCAAACTCGTTCATCTCATAGGGGTGTAACAACTAATTCACCGGAAATTTCTAACCCAAATATTCCAACGATTCTCTCTCAGCAAGAGGGTGTCTATTATCTGTTTTGGAGCTCATGATTTGATCGGTGAATCAGATTATTGCATGACGTTGCAAATTTTGGACATTATAATTCAAAATCTTTGAAAGTCTTTGTGGCAGTGGTTTTACGACTTCGTCCATAGCTTCAGTTACATCATCTTGTTATCCACCAGATTTCATTAATATCGGCCATTCAAAAGATAGTACAGCCTTAACTAGCCTCATATGTGCTCAAAATAGGATACATGTCATTTCATTATATGCTGAAGCAAATAATGAGAAATATTTACACAATATGATTTAATTTTTTTCATCAAACTTAATTTGAA
>TRINITY_DN11_c0_g1
GCTATCTTAAGTTCAGAGATATGGTCATATCTAGCTTGTTGTTGCCGATACCGGAAAATGTGCCTAGAAATAGATCAATTAATCGATCTGTAAGCCACTATCCAAAAAAGATTGAAAAAAGGATCAGATGCCAAATTTGTTCCTCAAAAAAAATTAGGTCACAGACTTTTTATATTTGTGACGTATGCAAAGACAATAAAGGTAAAGTAATTGGCCTTTGCGTCGATCCTTGCTTCAAAGAATATCACGAGAAGAGTACATAGGACAATTTATTTTTGATTCAAACTTTTTGAAAATAAGTTTTTGAATATTGAAATGTACGGAGTTTTTGTTTTAGTTTTGAAATAATAATTATTGTTTTATTTTGTGTTCAATAAATTGTTAAAAACATATTATTTGCATTGTTTTCATACCGACTCATATATGCGCCAAGTGGGCTATGTAAAGAAAAACTACAAATAGCCCGACGGCTCATATATGAGTCAGCTCAAATTTGCATGGTGGTCTCTGTGGACGAAACATAAATATGGCCCTGGTAGCGAACGTGTTAATGCGCTGTTTCAGGCCAAAACAGTCCTTATCCATCAATTAGGAGCAGAAAGCAG
>TRINITY_DN140_c0_g1
ACATCAAATGACTACGGGCCATAAATTTGATTTTGATAATGTACAGATTCTTGATAGGGAAGAGGTTGGTTATAAAAGAAATATAAGCGAAATGATTAATATAAAAGTAAATAACACAGTTAATCATAGAGAAGATGTACAACACCTAAGCACGATATATAACAATATAATTAGAAGATGAGTGCTGGCCACGTCAATAGTGTTAAGTCCATTTTATATTTTTATCATAATCATATGTTTATGTCATTGTCGTATTGGAAATAACTTAATGGATGTTGATGTTGATTATCTGCGGTG
>TRINITY_DN62_c0_g2
TAGTTCGTCAATCCATTTTTAATGGACATTATGCCCTCATCTCTGACACTTATGAACCAAATCCTGACTATTGGATCAGCATTCTTTACAAGAAATTAGTTGGGACTCGAGTCATCTCTTGTTTCAATTCAACTGGTAGTAGAGTCAGGCTTTATTGTCACTGTTCTAATAATAAAGCTCAAGAAAATGGTTTTCCTTCTATAACAGTTTATGGCATGAATATGCAGAATACAACCTCTATAACAGTTTACGGCATGAATATGCAGAATACAACTGCCAAAATTCATATTATAGGATTGGATAGAGATCCCAGAACATCGCTAAAAGTAGTTTCTTATACTATTTCACTTAAAGTAGTTTCTTATACTATTTCCAGCAAAGGATCACTATTGGGAAAAAATATCTATTTAAATGATAAATTGCTGAAACTTACATCCACTAATGATGTACCACAGAGGATCATTATTAGGAAAAAATATCTATTTGAATGATAAATGTAAAAATTAAATTATTTTCGATTTAAAAATGACCTGAATATCGATTTTTCTAGTATGTAATAAGAATTTTCATTTCAGAAATATCTATTTGAATGATAAATTGCTGAAACTCACATCCACTAATGATGTACCACACTTCCAGCCTAAAATAGTGGATGCAAAACCATACGTGGTCATTCCTCCATTTTCAATGAAACCATATGTGGTCATTCCTCCATTTTCAATAGTTTTTTGGATTATACCTATAAAAAGTCAAATTTGTAATTGATAGGAAATAAGTTGTTTTCTATTTTTTCGTTCCAGACTATTAATTTGAACTCTTATATTATATTTAACATTCTCTTTAAGTTTTCACAATTATTACCTATTCTTCAAAAAACTTTGTTGTTATCTGTTATGTAATACTGTGAAGTATTTCCTATTTTCTCGTTCCAGACTATTAATGTAAACCCTTATTTTATATTTAACATTCTCTTTAAATTAGATTAAGACCTATTCTTCAAATAAATTTGTTGTTATTTTTTTTTGCTATACTCTGAATAAAAGATTCTGGAAA
>TRINITY_DN37_c0_g1
TGGCGATGGATGTTCCTCCTGTATTTATAAAATTGTGAACTTTTTTATGGTTATTCAATAAACTTTCGATAGTTCAGTGAATTGATCGAATAACAAATAATTTCCGACAAATGGATCGTCCTTCATGTGATATTGCGAACAAAAAATTCCCGCCAGATCATTTGAGGATATTCATCTATAAGGGTGATGTCGAAAAGGACCTCATAACCACTAAAGAAAAAATCAAGCATCTCCTCTTCGCCTTCAGTTCCATTGAAAGTATCTCTGACGATTTTCTACAATCACTTCCAGATGTCGAGAACCTTGTCCTCAATGGAAATCATAAATTTCCAAAACTAACAAAATGTTTCTTCCAGAATTTTCCTAAATTAACCTTAATTTACGTCCACAACAACGAAGACCTACAAATTGAAGAGGATGCTCTAACAGACTTAGACAAACTGAAGATACTTTCTATACAGGGTTTAAAATACGAAAAACTAAATGAAAATGTGTTCAAAGGTCTCAATAACTTGAAGAGATTATCCATGGTAAAATGTGATATCTCGAAGTTAGAACAAAATACTTTCAAGGATAACCAGAATCTGGAAGAGATCAATCTATCTTCTAATAACTTGACAGGCTTTCAACTTGGAACTTTCGATGGCTTGGATAAACTCAAGGAGTTGTCTTTACAAAACAATAAGCTAGGCAATATAGACTGGTCACAATTTAGTACACTGCCATCTCTCGAGTACCTGGATTTATGTGATAACGAGATGACAAAATTTGACGTTGCCAAAATGAAAGAAATGTTTCCTAAAATTCAAAAAATCAACATCATGAGTAATTGTTTCACAGAAGAAGAGTTAACTGGTATTGAAAATGAGCTTATAAGTTTGGGAATAAAAATCGAATAAGGTGTTGTGTGTTGATGTTAATGGATTTTCCAATAAATCATTTTTG
>TRINITY_DN101_c0_g1
CATCATGTCCTCATGTTTTCCTGTAGGCCAGTATATTTTATATAATGAAATGTGGCGTGGAGTTCTATTGATGATAATTGTTTGGCAACAGCACCTACTAATGGTCATGTATGTGTTGCATTTGAGCTAACCTATAAGATTGTTTACCAACAACGCAAATATATCCTTTTTTGTCGATAATTTTCAAAGAAATGTGATATTAAACATGATTATCGCTTCAAGATAACAACTTCTTTCAATGCCCTTTACAGTTGTTCGCACTCCAGATTGCTCTTTGATGGCCAGTACTTTTTTTTGTGCCCAGGAGGGCCCTGTAAATGCTTTAGCATTAAATAAAGACTACTCTCAAGTTGCTATAGCTGGAAGAAATGTGTTTAAAATTTACTATATTGAAGATGACCAGTTCAAAGAAGTTCTTAATTTTCGCGCATCAAAACACTTAGGGACATGTTTTTCATGCAATGATGTGGCGTGGAGTTCTATTGATGGTGAGCAATAAGAAGATTGAGACATGGTTTTTGATTTCATTTTATTATTTTAGATAATTGTTTGGCAACAGCAGCTACTAATGGTCATGTATGTGTTTGGAATTTGTCTAAAACGGGAAGGGCTATGCAGGAGCAGGACTACCAGGAGCACAAACGAACTATGGAACTATGAGGTATTTTGATGTAAATAAAGTTAATTTTCATACTTCTGAACCTTACCGTTTAATTTCTGGTTCACAAGATGGAACTATGAGGTATTTTGATACAAGAATGTCATCTGCTGTTGCTATATTTTATAGCAACACTGAAAGTGTCCGTGATGTTCAATTTAGTCCACATAACCCCTATGCGTTTGCTTCTGTTTCTGAAAACGGTAGTGTACAGCTGTGGGATGTTAGAAAACCAGACAGGTATCAACAACAATATACTGCACATAGTGGTCCCATATTTGCCTGCGATTGGCACCCAGAAATGGCTTGGTTGGCAACAGCTAGTAGGGATAAAACAATCAAAGTCTGGGACTTAACAAATAAGCCATGTATATTATTATTTATTAGAGTTTGATATAAGAAGGAAATTTAAGACCATTTTTGAAATCACCAACTAATTTCTTTTTCATATATTTATACAGGCTTTTGAGGCCAGATTTGTATATTGAAATTAAAATGAAGATGGTTTTCAAAGTTATGAGAAAAGAGTTAAGTAAAATGTCGCAAAGGACCATGGCCAAAAAAAAAGGCAGGAACTTCCTAATTTAAATTTCTGTTGTAATCATTTCCTCATTTTCTCCAGTATTCCAGTATATTTTATATAATGAAAGAAATGGTCATACACATTTTTAGGTCTGGGACTTAACAAATAAGCCAACACTTGAATATACTATTCACACAATAGCCTCAATTGGACAGGTGAAATGGAGACCACAGAAAAAATATCATATAGCAAGTTGTGCATTAGTTATAGATTCTTCGATAAATGTGTGGGATGTTCGGAGGCCCTATATTCCTTATGCTGCATTCAACGAACATAAAGACATTGCTAGTGGAATTGCGTGGAAAGGTGATCCTGACTCATTCAGTGGAATTGCATGGAAAGGTGATCCTGACTCATTTTTGAGCACTGGACGAGTGAGTCTTTTTCATGGACAATTGCAGTTTGAAGAAGGATATTAAATTTCTCATTTCAGGATTGTACCCTTTTCCATCATGTATTGTACCCTTTTCCATCATGTTTTCAGTGACGCTGATCGACCAGCCAGTATGACGCTGATCGACCAGCCAGTAAGGCCAATTCACAAGCAGTTTCAATAGCCAATTCACAAGCAGTTTCAATGAACAAGAGGGGAGAAGTATTATTTGCACAAAAAATTATAGTTTTTAATAGTACTGCTACAAAAAGCACTAATAGTACTGCTACAAAAAGCACTATCGGGCTCATAAGAAAAACTTCTACAAGTGTTCCCCCAGACTATTTTCATCAGACCGCGAGTTTTTTGCAACATTTCACAAAGAATGCTCAAGAATGTGAAGAATCTGATATTTTTTTATATTTTGCCAAAAATTATGTACTTAGTGGAAGAACTTTGTCTGAAATGTGCGATCATAATGCAGCAGTTGCGAAGGAATGTAGAAGAGCATCAATTGCAAAAGTTTGGAATATAATAAAAACAATGTATGGTGAAGAGTTCCTACAGAATTCTGAAGTTATCACCCCTAGAAATAGGGAGAACTCAATGACTGGCTTGGTATCTTCCTTAGTTAATTTAGATAATTCAGCAAATGATCAGTCAAAAGATGGTGACACTCCTGCAGCTCAATTTAGCGACGAGACCGAAAATGAAGATCAGGTTGATCACATTGCTATTTATAACAATGGTTTTCCAACCTATCTCAATTATCGGACTGGTCTGCCAAGAGGAGATTTCTCTTTTGGTGAAAATGAGTTGGATATGGAGTTCGATGGAGTAGCAACTGATTTCAGGAATAGCTATAGGTCTTTTCAACCAATACCAGTTCAACAGGACTGGACCTTGCCAAATGAGGCGTTCCCAATCAGACATGAAATCCTTGATCGATCTCCACCTGCCGATCAGTTTCCCAACAGAAGTTCTCCAGACATACACGAGGATCCTTTTCCTATGCCTACTGCTATTCAAGAGCCTCCTCCAGGTATTCTCACAGTAAGATTACTTCCTAGGAAGTTGGCTTGGGACCCAGGGAGCATTGTTGTAGACGCTTTAAAATATCATGCGACAGTAGGTGACATACAGACTGCAGTTTGCATATTGATAGTCCTTGGGGAACAAAGAAAAAGTTTGGTGGATCTAGAAGACGCTACACAAGAACAGTGGCTCACTGGTTACATAGAGTTACTGACCAGATATCAGCTTTGGGACGTTATCACGCAAATAATAAAACTGTCTTGGATACCTACAATAGGTCAGCTTAATCAGCAATCAACCAGGATTAATTCAAACTGTAGCAAATGCAACAAACCATTACAAAGAATCGGTTGGTTGTGCGACAAGTGCCATTCTTCGGAGTATGCACTCTGCAGTGTGTGTCATCAGGTAGTAAAAGGATTGTATGTCTGGTGTCAGGGATGTTCCCATGGTGGTCATATGAGTCATATTCAGCAGTGGATAGCCAAAAGTAATATGTGCCCTACTGGATGTGGACATTTTTGTGAATATAGATAAGGAGCCGAACAATTAATATTTATATATAAATCTAATATATTTATCAATTTTTTACTCTTTTCTCGATTGATTTCAACATCTGTAGAACTGTTAACGTGAAAGGTACATTTTTTAGGTTAAGGTTATAAGCGATGACCAAAGATACCTCACTTTTTATCAAGAATGTTTGTTTTTCCTATTTGCATTGTATACAGTTTAATCCTATTTCCTAATGGCTGTTTTTCAGCCTGAAGTTTAAAATGCACATGTCTTCAGGACTATGTTGATGCCTGAGACAATAAATTCAACATGTCCAGTCTAAGTTTTTGTTATTTACACATTGGTTTATATTGATATTATATTTGAGGTTATTACATGAGTATCAGTTGATTTTAACTATGTTTTACACTATGCCTGTTTCAGGGCTGTTTATCAGCCTGAAGTTTAAAATGCGCATGTCTTCAGAACTATGTTGATGCCTGAGGCAATAAATTCAACATGTCCAGTCCACCTATGCAATTTTTATTTGTTGAACATGACTTCCTCAGGTTAGAAAGGACAGTGTCTATACAATAGTTATAAATATATAATACTTTTTGTAATTTCACTTGATGCCCCTTGTATGATTTTAAGAATAGAG
>TRINITY_DN29_c0_g1
GGTTTTTCCAATTAGAGGTTTCAATTTTAATAGCTTGTTATCTGGGCAGCTACCACTTTTGAAGCTGTAATTTTTTGATATTCGACAAGTTAAAACTACGCCATTACTAAAAATGTTTCAATTAGAGGTTTCAGTTTGAATAGCTTGCTATCTGGGCAGCTGCCACTTCTGAAGCTGTAATTTTTTGACATGTGCATTTTGAAACTACGCCATTACTAAAAATGGAAAGATACACCCTTCAACAACGCACTGAAATTGTTGAAATTCGCTACAAATATAGTGAAAATTTTGCAGTCACAGTCACACTTTTAGGTTATCGTGAAGCACCTTCGCGCCTGGCAATATTGATACTAGTGAAAAAATTTGAGCTGTTGGGACAACCAATGAAATTGTTAAAATTCGCTACAAATATGGTGGAAATTTTGCAGTTACAGTCACACTTTTGGGTTATCGTGAAGCACCTCGGCTTGCAATAGCGATACTGGTTGAAAAATTTGAGCTGTTGGGACAAGTAAGTAATGTGAAGAATGGAAACCGTGTGTGTTGCTCAAAAATAACTGAGAATATTGCTGCTGTAGCTCATAGTGTTGACAAAAACCCAGATTTGACGGTTTTTCGTCGATATTGGGAATTAGC
>TRINITY_DN94_c0_g2
GGAAAATATAAAATGTTGGAGGGACATTGTAACTCAGCTGATCACTTATGAAAATCAAGAAACTCTATGTTTGAAGGTCAAAAGGTGACGTCTTGGAAACAAGGAAGGTCAAATAAGAATTTATTTATTCTGTTTACTTATAATTTTAGATTTTCCCATCTAGTTTGATAGTAATTATCAGTGATAACGTTGAACCAATTGAACCGACCTTGTTTCCTTCGACTTTGAAATCTGTTCAATCAAAATGGCGGAATCCATCAAAGTGGTTGTGAGTTTGGTTGTATTAAAAAAAAAATAATTCTAATATAATTCAATTTGAAAAAATGGAAAATTTTGCAATACAATATTTTTTTAGGCGGAATCCATCAAAGTGGTTGTAACTGGAGCTGCTGGGCAAATTGCTTATTCTCTACTATACATGATTGCAAAAGGGGATGTATTTGGGCAAGATCAACCCTTGATTCTGCACCTTCTTGATATACCACCCATGATGGGGGTCCTTGAAGGTGTAGTTATGGAACTGGAAGATTGTGCTTTCCCATTATTAAGACAAGTTGTTGCAACGGCTGAACCTGATGTTGCATTCAATGATGTATCTTCAGCTTTTTTGGTGGGCGCAATGCCAAGAAAACAAGGGATGGAACGTAGAGATTTGCTTGCAGCAAATGTCAAAATCTTCAAAGTACAAGGTGAAGCCATTGACAAATTTGCTAGAAAAGATGTGAAAGTTTTAGTTGTTGGTAATCCAGCAAATACTAATGCCTTAATTTGTTCTAAATATGCACCATCTATTCCAAAGGAAAATTTCACTGCAATGACTAGATTGGATCAAAACCGAGCCCAGGCACAAATTGCAGCAAAAATTGGCGTCCCTGTTTGCAATGTTTCTAATGTAATAATTTGGGGAAATCATTCATCAACTCAATTCCCAGATGGTTCTCACTCTGCTGTAGAAATAAATGGTTCAAAGAAACCTGTGCCAGATGTTTTGAAAGATGATAATTGGCTCAGAAGCACCTTTGTTGAAACAGTTCAGAAACGTGGTGCTGCTGTAATTAATGCTAGAAAAATGTCTTCAGCTATGTCTGCTGCTAAAGCTGCAGGTGATCACATGAGGAACTGGTTCAAGGGCACAGAACCTGGAAAGTTTGTTTCAATGGGAGTTGTCAGTGATGGAGCTTATGGGGTACCAAAAGATATTGTATTTTCTTTTCCAGTTACAATTGAGAATAAAAATTGGAAGATTGTTCCAAACTTACCTATCAATGACTTTGCAAGAAAAATGCTGGACACCACTGCTAAGGAATTGGAAGAAGAACGCACTGAAGCTATCTCTATAATTGAAGCATGACTAGTTAGCAAGCTATGAACGCTTATAAAAAATGAATATTTTCTATTCAAAGTAAAATATCCAACCCGAAAAATACTCTTATGGAAATTACATTACTGAAGATTTTTAAAGCACAAATTTATATATTCAAAATATTGAATTTTTTTCAAATTGTATATAATATTTCGTATTGTGAATAGAAAAAAGATATTAGGTGAAGGAATTCCGTGAAACTATATAAGGTTTATGAAGAGCAAAATATATCTGAATTAAAAAATTTTCAATAAATCCATTTGTTTAATTCATTGATCTTCTTTTTGAAATGTTTATATCAATAATGAGTTTTTAGAATGTTTTCTATAACGCTGAGCAGCACACCAACTATTTGACTAGCAAAAGTTTGTGCTTTATGAAATTTCACATATCTGAATTTGTTTGTATATGTTACCTAACAAACCTAATAGCATGTACATTTTCAAATTTTTTCCAATTGTAGATGAGTAGCAGTCTTTTTCAGAAGAAAAGGGTAAAATATGTTTTCGTATGAAATAGCGATACAGATAGAAATGCAAACAGTTGTTGTCATTAGAAGTCGAATAATGGTCAAATAAATGAAAAATCTAGG
>TRINITY_DN94_c0_g1
AAAAAATTTTGACAGATGTTTTTTGAATGGCGGAGGCGCGTTCCATTCAAAAATTTGAATAGAAATAATTTACTGTATGTTTGAAACTTTACTTATAATTCATAAAAAAAATTACTTTCATCATTGAGCGGAAATTGAATGAAGTCTATTGAGTGTTGCATGTAATTTATGGTTGTCATGGTAACATATTGCAGTACAAACTAAACTACGAGAATTGTTAACTCCAATTTTCAATTGTGGAAAATAATGAGGAAATCCTCCTTTTCAGTCGTTCGCGATGAAGATTCAGATGGTTCGAATAAATCTTCCGATGCAGAGCTTGCGCCACTCAGTACGAAAAATATGAAACAATTCAAGTATTTAGATAATTTGGAAAATGTTAGAATAGAAGACGACGATTCGGATGAAGAAATGAAGGATTCTGGCAAGGTGACACTATGATTCGCTATGCTTTTTGGAACTTAATTAATTGATTATCTTTAGAAGTTGCCGAAGCAAGAATCAAAGTTGCCGAAGCAAGAATCAAGGAGACTTTCAGCCGGTAAAGACTTTTCTATACCGCCAGACGCACCTGTGAGAAAATCAGCATTGACAAAAGTAATTAGAAAAAATTCTAGTGGAAGCGAGGAAGAAGAAAGCAGAAACGATGAAATAAGTAAAAATATCAAAATACCTAACGAATACAACCCAAGTTTGTATCAGAATTTGGATGTAGACGATGATATAAGAGAGTTATTTCAATATATAGTTAAGTGAGTCTACTCGCATTATAGATACTTTTGATGAGTATATAAACTTGTAATATGTTCATTATAGGTATATGCCTCAACAATTAACTTATATGCCTCAACAATTAACTTTGGACTATAAATTCAAGCCTTTCATACCAGATTACCTGCCAGCTGTAGGCGATATCGATGCATTTTTAAAAGTTGTTCCACCTGAACCTAGCCTTTTAGGAGAACAATTCAACATCAAAGAACACCAACTTGGAATTTCTATACTAGATGAACCTGCTACCACTCAAAGTGATTCTGCTTTGCTTCATTTGCAGTTGAGAGCTTCAAATCTTGGAGTTCCCCAAGATACATCAAATGTGGTATGCTTTATTTCAATTAATAACATTAGAAGGAATATCGCATGATGAGAAGACTCTATTTAAAAACTGGCATTAATATTGTCAAAAAAGTTGACAAGGTGGATAAAAACCAAAAAGTAATTGACAAATGGATCAAAGATATATCAGATTTGCACAAAAGCAAATCATCACCCTTCGTTCGATATACAGAGCCGATGCCTGATATTGACGATCTAATGCAAGAATGGTCTGAAGAAATGGAAAACCGTCTGAAGGAACATGGATTTCCATCACCTGAACCAAACATGTCTTTGGATGAGTATCTAGAATTGGTTTGCGATTTATTCCAGATACCAACATCGAAAAATAAGATCCATTCCTTGCATGTACTTTTCTCATTGTATGCTGCAGTGAAAGATTCTAAATTTTACAAGCCAGCCATAGATGAAGACAAAAAAACCGAAGTGATAGATACAAATAAAGATGAACCAGATCAACTTGTTCTAGACTAGTTATAGGATGTGAATTAAAGTTTTAACA
>TRINITY_DN114_c3_g1
TGACGTTTCATCGTGGGTCCTTGAAAAGTTCACCCAAGTGATAGCTTCGAATGATCCATCATTCAAAATGCAAATGCGAAACTCAATAGGTACTTCCGTAGTATTCTGAATTGATATTTCTTTCTCCACAGCGAAACCAAAGGCTACTATACCAAAATCGATCTCCTCTATATTATAACTCAGCAAAGGGCATACAACATTTCCTTGAAATACGCAATTGACATATTCCCCCGACTCAGCTATTCGGAAATTCAAATTCTCCAAAAATTTCCCCTGCATAGTTGAGCTGAATTCAAGAACCATTTTCTCGCATTTTCCAGGCTTTATGTGGACCTCGTCTGGCGAACAAGACATCAAGCCACCAAAGTCCATGTTTTTGTGACAGTAGGTGAGAGTTGCGGGTATATGACCTTCATTTTTGGCTACTATCTCATATTGATGCTTCGCGCAAAGATATAAATTTTCCACATCCAAAACTTTAAAGTTGAAGCACACTTCTGGACCGAGACCAGTTCCAACCATTTTCAGTGGTTGACGGGTTTCTCTTCCAGTGACGTCTAGATAAGCCACACTTTCGTAATGGGTTGCTTCTGTGGGACAGAAAACCACTTCGATATTGACTACACTGTGTGGACCAATGACACCATTAGTATCCGTAAACTTAAAGTTTGGGTCATGATAAAGGAACTGATCAGTAGAGTCAAATTCAGCCAACTCATCCTCGTATATCCTGTGCA
>TRINITY_DN78_c0_g1
GTCAATTTTTTTGAAGTGTTTTCCCGAACTCCCATTTTAAGATTTTGAAACATGGAGTTCGAAAATAGGACATTCGAAACAACATACAGAGGAAGTTATATTCGTCAAAAACTACCTCCCCTCATCAAATATAAGAGCCACCAAGAATTTAAAGATCCTATCGCTGAAAGCTATAAACATTATCTCTCTACAGATGCAGGGAATGAAGAAGACAAAATAGAAAACTGTCACAGTTTTGTGAAGAAATATAGTGAAAAACGCCCAAGAATTGCAGACAAATACTTCAAGGTGCCCATGAATACTACAGTTGTGGATGAAAAGGAAGCCTTTGAAAAGAAGACTGCCTATCATCAACATTTTTGTTCATTCGATGGATACGAAAAATTTCTTCCACCTAAGGAGAAACCAAGAGTTCCACTGCCAGAGGGTTGGGTAGAAGGCACTACCACTCAGAAGTGGTCTTACAGAAACCCAGTTATTTTATTCCCGAATATTTATAGAACCAGGCCTACTTTATTCAAGCCATTATGTGAAATGGATGAAGCATATAAACATAGCCTAAAAAGGCAGAATATAAGCGAACTAGAAGGAGTAATAGGAGATCTAGGAAGATTTGTTTTGGAAAATGAAATGCACGGACCTATTTCAAAATTTGACCTATGAAGTTTTTTCAAAATCTCTGAGTTTTGGCCCACCAATAAAAAAACACTGCA
>TRINITY_DN72_c0_g1
ACATAAATATATATTTTAACAATTTAAATAAACAAAAGAAAATAACGAAGTCAATTAGAAACCTAATTTTACTTTGGCATCAGTCGAAATGATTAAAATCACTAATTTCAATGTTTTGAAGTAGCTGCAGTGGGTTGATGAGCTGGTCTCCAATCGCTTTGCTGAGAATACTGAGTCGTTGGAATCTTACTAGAGTACTTTTGATGAGATTCATTAGTAGCACTTATCTCTCTGTGCTCGAAAGAATCTTTGTCTTGTTTACCATCCTCCCCATGCTGACTTATATAATTCTTCAAGTGGTTCTTGATCTGATTCTGTTGTTCAGCACTGAAGTTTTCCAGACCTGCTATGATGGCTGGTGCTTTGAAATTGGTCGGCGACTTTGAATATTGCTGTGCAACAACTTGGGCTAGCTGATTCAAGTAAGAATCGCCCTGTACGCTAGATGGCGGGGCATAGAAAAGTCCAGAATTTGAAGCTACTAACTGATTATTCGCTTGGTAATGTGATGCCAGAGAAGCAGGTCTTTCTGTAGCCACCAAATGCTTGTTGTTCACTTGGTAGTGAGTTGAAACCGAAGAAGGCTTCTCTGCAGCAGGTTGAGCTGTAGAATACACTTGGACAGATTGCTCTGCAGGGTGCGATTGGTATGATTGATGAATTGGGTAAACTGTAGGACTTGCTGCAACATTATAATGTATCATCTGCACGTTAGAAATTCCTGAACCATCTTGGTGGACCGATGGGGATTGTCTCTGGATATTTGCAGCTTGATCTGGTGTCAAGTAAACTGGAAAAGCCTTAACTATTATAAGGGCTGCTTGGGGTTGTTGTGTGTAGACAGAACGTTGTAAAAGTTGAATCGGCACAGGGACATAATGCTGAGGGTACTGTTGTGGAACTGCCCTCTGTTGAACTAAATACTGTTGATTCGGATGGTTCTGGAATTGAATGTCGTTTTGCAGATGAGCACCTTGGATGTCATCTTGCAGGCCCACTGAAGATCCCAAAAGGCTCAGTATCACGATTGTTGAAATCATTCTAGTCGCAGCAATCATCCTTAGGACAACAGAGTGATTTCATAACCACTGGCAAGAGGTTCCAAAGGAGTAGCCATGCTATGGATCCATAAAATAATAAAGCCGTGAAATACATTTAATTTTGAGGAATTTTGACGTCCAAAACAAGAATTATGAATGACAGTACTGACTGAAAATTTG
>TRINITY_DN179_c0_g1
CAATGGCAATGTATGATAATAACTATTGATATGAAGCTTGATTTCCAAAAACATTGTACATCCTTATTTTATGGCCGAAGAAAATGAAAATTGATTAAAAAAAGAGAAACAGTGATACATTAAGAACAATCTTCTAGTGTCACTGATACAGATCATCCTTATTTCTTTCCAGTCATACTTGCAACCACATCACTTAATACGGGCTGAGGAACTTGCTTAGATGCTTCATAGGAATCCAGAATTGGCCTTACGAAGGCTGGAAGGAAAAGACCAATTCCTCCGATTATACAAGATGCAGCCACCACGGGCTCTTGAACTACGAACATCTTCAGCTTCTCCATGACAGGCATTTTCTCGAAACTTTCTCCTGATTCGCTGACCGTTCTTGTTCGTGGCTTGATTCTTCAAAG
>TRINITY_DN19_c0_g1
GGGGTGTAGAAAAATAATGTATTGAGTTGGTTTCAATTTTTACAGATATCGATATTTCAGAATTATCTTCACTGATTTTTTGCTTTCAAGATTCAGGGATTGTATTCTTGAGCTGAGAATAGTGTAACAACTGATTTTCTTATCGAATTCCATGTAAATATCGGAATTGAAGGGACGGATGGATTGATAGATTTTTCATTCTATTTTCAGAGAGGTACTGTTATGGATTTTTTTTATTCAAAAGATAGTTTGAAAA
>TRINITY_DN63_c0_g1
CACTTTTTAACCTTTTTATTTCTTGTTATCAAACATTAATAATGTTAATTGAACTCGTGTATTACATAATCGTATTGTTCTGGATGTCTAGAATCGGATGATTGATCATTACCGTTGTAGTCTGAAGAAGGTGGAGAACACTAATCGTAATGTTCTGGATGTCCAGGTCGGATGATTGATCAATACCGTTATAGTCTGAAGAAGGTGGAGAACAATATGACGAAGAAGCTCTGTTGGTTGATCGCGATGCAATATTCGTGATATGTGATGGTTCCCGCTTACGCAGTTCCTGATACAGCAAATGCTGTACTTGAATACGAAAGTTTAATTTATCTATCGAAGAAAGTTGCCTGACATGCGGCAAAAGTGATTTGAAAAAGTTGATGTCGTCATCGTCATCGTCAGTATTTCTCAAAATATCCAATTTTTCAGCTTCGAGTTTCAACATCTCACGTTCAAAACTATCATGCTGATATTGTGAGGTTCCAGTTTTTCGTTTTCTACTAACTTTTAAGACGAAGAAGCTCTGTTGCTTGGTTCCAGTTTACACAGTTCCTGACACAGCAAATTTTGTACTTGACTACGAAAGTTTAATTTATTTATCGAAGAAAGTTGTCTGACATGCGGCAAAAGGGATTTGAAAAAGTTGATGTCTTCATCGTCATCTTTAGTATTTCTCAAAATATCCAATTCTTTAGCTTCAAGTTGCAACATCTCACGTTCAAAACAATCATGCTGATATTGTGGGGTTCCAGCTTTTCGTTTTCTACTAACTTTTATCGGATATTTCGGACTACTTGAGGAAGGCAAAGATTTCTCCAGGATTTTTGGGACTAGTTGAGGAAGGCAAAGATTTCTCCAAGTTCTCCAGTTCCTTTTGTAAACTTGTCGGTCTACTTCTTTTCGAGAGTCTTTTCGGACGAATTGCTGATTCAGGAACGTCTTCATTATAAGTCAATTCCCCATCTTCCTTATCGCTTTCCTCTTGTTCAATCCATCGATTGTCTTCAGACTCGTCATTTTGTAAACTTGTCGGTCTTTTTCTTTTCGAGAGCTTCAGACGAATTGCTGATTTAGGAACGTCTTCAATATGAGTCAATTCTTCTTCTTCCTTATCGTATTCCTCTTGTTCAATACATCGATTGTCTTCAGACTCGTCACCTTCTAGCGATTTAGATAGGGATTCATCTCCAATAATATTTTTCTCCTGACATGATGGCAAGTTACCTTCAGTTTCTCGAGGAGTTAATATTCGTTTCAAGAAATCCATATCTTCAAAATAACGCCATGTACCCTTGTAACGACATGTCTTCTTGCGATTCAGATTGGAATTCATCTCCATTAATATCTATCTCCTGAGATGATGACAAGTTACCTTTAGTTTTTCGAGGAGTTAATATTCGTTTTAAGAAATACATCTCTTCAAAATAACACCATGTACCCTTGTAACGACATGGTCCTTTTGCCTCCTCACCTGATCTGGACTTGTGCACTTTTTTTAGTTCTCTGTTGAAAGTATCACGAAGATTTTTCCACTTTCCTTTAACTGCTTCCTTTGGTTCCCCCAGTTCTTTGGCAATTCTTCTCCATTCTCTATCCACCAACAGTCGATTATGATACCTTTTGTCAGTCTTGTCCCACAGTATTTTGGAATTTCTAACAGCCACTATTAATACCTCGTTGAAATCCGTCATTGTAGAGCGATTCAAGTAATCGTGCCTGTGTCAAGTCTCAACATGAACTACTGACGTCGCGCGAATATCGCTAGGAAATATCAAATAATTTGATCGCTGAAAATATCCAATTCTTTAGCTTCAAGTTGCAACATCTCACGTTCAAAACAATCATGCTGATATTGTGGGGTTCCAGCTTTTCGTTTTCTACTAACTTTTA
>TRINITY_DN168_c0_g1
GCTAACCAAATAAGAAACGACCCACATCTGATCTGCCGAGTAACTGAATCTTCAGTTTTTTTTTTCAAATTCTTGTAACTTATAAACGAAAACCCTGTATATCAGAACAGTGTAACACCCACAAAAAACATTAATGGTGGATTTCATGAAACATTTATCGTGGTGATTTGCTCGATCGAATCATTTCTGTGTTCATTCAGTTAATTTTCGACACTTCCATAGATTTAAAACTACTATCAACGAGTAGTCAATAAAAAT
>TRINITY_DN109_c0_g1
CGGAACAGTTGCGAATTGTGTAGAAGTGTTAAAAGTGCAGAGTGTGTGGTTTTACTTTGGATAGAGTTATGTCGACTTGCTGTGCAAAAGAGAGGAGTGCTGTGAAAGATGCATTTCTGGGGGAAACCCAACCGATGGTTAGAAATCGGAATAGACCCAGAATAAGGACTTCATACAGAGTTTCCCAGATTTTCGCGTTAAGATGAAAGTTCCCTTCGAAAATGGTTGACATGAAATGTCTTTTTACGCCACCTGTTTCCAGTGTGCTCAAGAGACGGAAATGCAAGATTAAGAGTTTCGTGAAAAAACGTTCGGAACAAAGATCGAGGAAAGTTTGTCAGCTGCTTGAGGAGCATGTTACAGAACCCAGAATAAGGACTTCATACACTCTTAACATACAATAACAATTATAATTTTCAATCCTTCAATATCAGAGACAAGGAGTGAACCTCGGTGTTGCACCCAAGTAATCGTTGTATGTGTGTACTTACTGGTGATCTAATCTTTCTCAATAAGTACTTGATCTCTCCTCCACGTGGTGGTCTGACCACTACCTTTGCAGGTGTGCCCAGAAGTAGTACCTTCCTTTAACACACCACGACGTGGATTCATTTCGATCATGAAGTTTCAACATGTAATATTTGTGAAGTGGTGCTGTTGAAGGAGCGTAACATTCTCTCTTGGCTATAGTGGTTGGTGCTAAGAATGACCATAACTTCTTTGAACATTGTCGATGGGAGCGTTGGAAGAAGAAGATTACCATATAGTGGTTGTATTGCTATGCATTTTTCTTTGGTGTTTCGAAGGTTATAGGTGCAATAAAATCTATTGTGTTCAACGTTTAATGCTCCTCAAACTTGCAATGATCCATTAGAGATGTTGGGGAATATTGGTGCAAAAAATTCCATATTGTATCGTGTGTGCTGGATGTATTTAGCAGAATAGGTTCGAAATATTTCTCTCTTGGATATAGTGGTTGGTGCTTAGAATGACCATAACATCTTTGAACATTGTCGATGGAAGCGTTGGAAGAAGAAGATTACCCAGAATAAGGACTTCATACATCGTTGCAGGAGTTGTAGTGGTATTAGTGGTCGGATTTGTCGTCGCCTATTCTCTGGGGGCGTTCAAGAAGAAAGATGGGAAGAATGATTTAATACCACCTAACTTTGTCGTCGCCTATTCTCTAGGGGCTTTCAAGAAGAAAGATGGAAAGAATGATTTAATACCACCTAACCCCCGTAAACCACTGCCACCTTCCGCTAGCAGACAGCATACCTTTACCAAGGCAGCAGTTTGTGCAGATTAGACAGCATACCTTCGCCAAGGCAGCAGTTTGTGCAGATGGACCGCCCTGTGCCGAGATTGGAAAAAATATCCTCCAGGATGGGGGAAGTAATTCAAGAAATAATTAATATTATTGTTTGAAGAAAGTGAAAAACTCACTCAATCCAATGTCTTCCTATAGTTCATCGATTAGGAAAGGTATTCCCATATGAAGAAATATCCTCCAGGATGGGGGAAGTGCTATAGATGCTACAATAGCCGGAAAAAATATCCTCCAGGATGGGGGGAGTGCTATAGATGCTACAATAGCTACTATGATATGTAATGGAATATACACGATGCAGAGCATGGGAGTCGGGGGTGGATTTTTCATGACTATTTACAGTAAGAAGGAAAACAAGGCATATACACTGAATGCAAGGGAAAAAGCACCTCTAAAAGCCGATCCTGAGATGTTTAGATCTAGTCCGAACATCCCAGAAATGTTTAGATCTAGTCCGAACATTTCGAAACATGGTCCTCTTTCAATAGGTATCCCAGGGGAATTGATAAAACATGGTCCTCTTTCCATAGGTATCCCAGGGGAATTGATGGGATACCATGAAGCCCATAAGCGATTTGGGCGTCTTCCTTTCGCAAAGCTTGTCGAACCGTCTATTGCATTATGTGAAAAAGGATACCAGATGAGCAGACACCAAGAAATGTCTCTAAGGTTGAATGATATCACGAATGACACGAACCTTAGGGAATGGTTCATGACTGAAGACGTTTCGTTTGCACTACTCAATTGGTAAAACATGCTCACAAAATGTCATTGATTTAACTCTACATCAATTTTAAGGGAACGATAATTTTTGTTTGAAAGCATTCAACTCTTCAAGAAAAGGCCTAAGAGAATAATTCGTTTGCTTGAGAGACACTATTTAATTTTCGATAAAGATTCACCCCCTTCAACTCTCTTAAAACTTCGGCAACAATTTCGGGAATGGTTCATGACTGAAGATTAACATGATTTCACTTCGAAAATTAAACTCAAGAAACATATTTATAGGGAATGGTTCATGACTGAAGATGGAAAATTCAAGAAAGCAGGTGACAAAGTTATACCGAAGAAGTTTTGCGAGACTTTGAAGATACTAGCAGCTCAGGGTCCATTAGATTTCTATAACGGATCTCTAGCGCAGATAAAGTGGTACCGAAGAAGTTTTGCGAAACTTTGAAGATACTAGCAGCTGAGGGGCCATTAGCTTTCTATAACGGATCTCTAGCGCAGACAGTAGTAGAAGACATTCAAGCTATAGGAGGTATAGTCAGCAAGGAAGATCTTTCTTCTTATACGGCAGAGTGGATGGAACCAGTAAGCATTCGCTTGAGAGATGACGACACCTTCTATTCAATCAAACCACCTGGATCTGGTAGCATTCGCTTGAGGGATGACGATACCTTCTACTCAATCAAACCACCTGGATCTGGTGTACTTCTTGGCTTCATATTAGGCATACTGAATAACTATAATTTCACAGCAAATGATATAGGAAATGATGAGAGTACGATTCTCACATATCATCGTATCATAAAATGATGAGAGTACAATTCTCACATATCATCGTATCATAGAAGCTCTCAAGTATGCCTACGCTAAAAGAACTGAACTTGCTGATATGGATTTTGTCAATATTAGTTCACTCATAAACAATCTGACAAACGCTGCTTATGCTAGGAATATATACGAAAAAATAATGAACGCTGCTTACGCCAGGAATATATACGAAAAAATAATTGACAACAGCACCAATAACGATCCAAAATATTATGGTGGAGTAATATACAACAAAGAGGAGCATGGAGGAGTGATATACAACAAAGAGGAGCATGGAACAGCCCACATTTCTGTTATATCAGAAGAGGGAGATGCAGTTTCTGTCACTAGTCACATTTCTGTTATATCAGAAGAAGGAGATGCAGTTTCTGTCACTAGCTCTGTGAATATCTATTTTGGTTGCGGCTATACCTCGAACAGGACTGGTATCATACTCAACACCTCAAACAGGACTGGTATCATACTCAACAGCGTCATGGATGACTTCTCATTTCCATTTTTCAAGAATTATTTCGGATTGCCAGGATCGCCGAACAATAATTTGCAACCCGGGAAGAGGCCATTTTCATCTATGAGCCCATCAATAATTGTGGACAAGAACAATAATGTGAAGCTCGTTATTGGTGCATCTGGAGGAAGCAAGATAACTAGCTCTGTAGCTGAGGTCATCATGAGAACTTTATGGTTTGGACAAAATCTGAACAGCTCAGTAGCTGAGGTCATCATGAGAACCTTATGGTTTGGACAAAATCTGAAAGAAGCTGTTGACGCTCCTCGATTTTATCATCAGCTGTATCCAATGGTTGTGCAATACGATTATGGAGTGTTACAGCAAATCGTGGAGGGACTGGAGAAAATAGGCCATAAAGGACTGGAGAAAATAGGCCATAAAACAGAAAGGACCTTGGGTTCGTCTTCAATAATTTGCGCCCTTCTGAAGACAGCTCAACAAATTGTGGCGAATGCAGATTACAGGAAGGGTGGAGAAGTTTTCGGCTTGAACTGAAATGCAGATTACAGGAAGGGCGGAGAAGTTTTCGGCTTGAACTGAACCAAAACAATACCTTCGTAGCAAGAGGGAAGCCAAAGACTCTAACTGAATTTGTATTGTGCTAAATGTTACAACCCCATCTTCCTATTGATGCTCATCGTTATCTTCCTATTGATGCTCATCGTTTCCAACCAATACTTTGTTTCTTCTTCTATTTATTCTATCGCTTCCTTCATTCTTCACCTCTTCCGTGAAACAAACCAATACTTTGTTTTTTCTTCTATTTATTCTCTAGCTTCCTTTATTCTTCACCTCTTCCGTGAAACTTTACGCTAGAGTGGAATATTTCTCGAATATCCCCCATGCTCAATGTTTCCAGAATGCTTTCGAAAGCTTCGTGAATGCTTTCGAAAGCTTCGTTCCAATTCAGTATTTATATTCCTTGAACCGAATGTATTATTTTGCGAATACTACTTACATTTACGAGACAATGCTTTGATGTGAAGATTGCTGTTTTAATGTAAATATATTTATACGATTTTATTACTGTTAATAAGTAAAATAATTTCTCTCTCTAATGAAAAATTCGA
>TRINITY_DN58_c0_g1
GCCACATGATATCTGGCAGATTCAGGTAACCATGGACAAATGAGAGCAAACAATAGTAGAGGAATTGTGGACAAAGCAAGTAACCATTTCCAACCTAAAGTTGGCATCACAATTAGAGCAAGGACCACTTCAAAGCATGCACCTAATGCCCAGAAGCAATCAAGCAAAACAACACATTTAGCTCTCTGTTTTGTAGGTAAAAATTCAGCATACAGGGTAACTGATTGAGGGGTACAACCAACAGCAAAGCCAACAAGACCTCTGAGAAATAGTATCCATGTAAAGCTAGGTGCCAGTGAACTAAGAATACCATAATAAAATAGTAATACAGCACACAGGGATAAGGCATGCTTTCTTCCATATCTATCACTGAGATTTCCCCAAAAAGTCGAAGACAGCATCATTCCTAAAAAGACTACAGTTGTAGTTAGAGCTTGTTGATATCTAGTTATATGCCAGTCACAATGAAGAGATGGCGATAATATAGATAAAATTGTCATTTCCATGCTATCGGCCATCCAGCATAAGCCTGTCCATAAAGATAACTTGACTTGGAACCAACCAAAACCCAAAGCGTTAACTGCCTGAGTAATGGTAAATGTATCATCTGGTACGACAGATACTGAAGCCATTTCTATTTCCTGTGGAATTTGGCATTCTGGGTCTACTAAAACAGTATTTCTAGATATATTAGATTTATTTTCTGCATCTATATCTTGGTATCCTTTAGATCTAAGTAACCCCATTTTGTTCGAATAATATTAATAGAATTTAATAAGTTAAATCAAGTCAAATAGAATTTTTAAACACGAAAATGAGTATTTAATCTTTATTTCTAATTAATGAGTATTATTAATAAATATCAAGTTTTGTTTTCAAAACTTTCTCTCAATTTTGAGGTTACA
>TRINITY_DN30_c0_g1
CAAAATTAGAACAGCATTGAAGTTTTTCACGTTTCTGAATTCATCAGCTGAGCTGATATTCGAGCGCAGCATGTTTCATACGTAATAAGGCACTTTTTGTGGCATTGTCAACCATCCAGTGTTGCCACAAGAAGTCACACTTTCACTCCATTTAAAACAATCTACAATTTCGAATTCTCCACTCGTGGGAACATACCTTACACTCAACCAATAACAGGAAAGTAGAAAATGTGTTGAATTCATCTCGGTATAAATCGACCTAATATCTCACCTAGTCAAAATTATAATTCGGTGCAGGTAGGAGAGCCTCATCTTGACTTACCCCTCCTAAGGTCACCTCATAAGCTTTCATTGAAAACGTCAGGCCTGAAAAAAAAACATTGACATACTGATGAATTTACGAGGCCCAGAAGAGGAGGCCAGTCCGTCACAGGAACAGCGGTGGCCTTTCCTAAACTTTGGGCAATTCTAATTCCAATTAGATAAGATATTGGTGTTATTAATTTTCCTGTACGGGATGGTTTTTCAGCGATTAAAAGAAG
>TRINITY_DN90_c0_g1
GTTGGAAGTATAAAGCATAGAGAAACTGAAACAGGTAAAATTGATCCAATCATTAACTTCTTTGCAGATTCTGTAGCAACAGACCATATCGTAAATGATTGTCTGACTTGAGAAACTTTGAGAGATGTCAAAATATGAGTATAGAGAGCGAATAAAACGAGATATAGAGAGCGAATAAAACGAGATAGCAGTCATTGTAATCGATAGTAAGGGTGAGTTAATCTTATATTCAGATTTTAGAAATGAGAATACTAAGAAATTAGATTCTAGAAATGAGAATACTAAGAAATTGCAAAACGTATTTGCAGAGAAAGAGATTTCTGAGAATTTACTTCCCTTACATAAACTCGCAGACTCTGGGTTCAGTTTACTTCCCTTACGTAAACTCGCAGACTCTGGGTTCAATATTTACTTAGATGTCCAAGTCCTAAAAGTTTACAATAAGATTAATAATGAATTTGTTTTAGAGAACAGGTCCTAAGAGTTTACAATAAGATGAGTTTACAATAAGATTAATAATGAATTTGTTTTAGAGAACAGGTCCTAAGAGTTTACAATAAGATTAATAATGAATTTGTTTTAGAGAACAGGTCCTAATGAGGTTAATA
>TRINITY_DN137_c0_g1
TGCATGTTAATTAATTATTTCGGTTCAAATTGTCATTCTATTTTTCCGTACTCAAAAAACGTTGGGAAAAAATCCAAACACTGTGAAAAAAAAAAGTTTAGAAAAGGTCTTCAAATAAGTCGATAAGCTTCTTAACGTTTTCAATTAATTGTTGGGTTTCTTCAACCAATTTCGCTGATGATGATGATGACGACGACGAAGATCCAGATGATTTCTTAGCGGGTCTCTGAAGTTTCAGACCAGCTCCGGCACCGGTTTTGGTGGCGTTCACTGTCTCTGCCGCGTCTTTCTTCGCTTGTAGACGGTCAATTGTGCTATGTACGTTGGTAAGGTGGTGATCGTAGTTTGTTACAAGAGACTTGAACTGTTTGTATGAGTCCGGTTGCGCCAGAGGACATAGCAACTTGCTCGATACTGAGCATACTTTTTCAGTCGAGCTGGGTGCCTGTGGAACGGTTGCAGCCGGGTCAGCTTGGCAAACAAGGGCGATCGATGATAGGAAGAAGCTGAAGGCCTTCATGGTGAATTGTGATGGTAGATCGAGTGAAGTGAATTGAATGGAGTTATA
>TRINITY_DN81_c0_g1
AAAAATCCATAAAAAATTACATTTTTAGTTATATCTCGCAGATGGAATGAAATCGAAGGAAATTATTTTCGGAATATAGTTTTTTAATGATGTGATGAATCTTTTCCGAACATAAAAAGACCGGTCAACACAACAGAATGCTTGCTGAGAAAAAAAAATAGAATCGCAAAAAATAGTACAGGAAAAAGTTTTTTTTCACCTCAGGAATCTTCAGTTGTAATATATGTACTAGTCAAATACTCACCCTGTATATACCATGTGGCTGATATTTTTCAGCAGAAATGGAGATTTTCAAAATTTTCTCTAATTTCTGCATTTTCCGAAGACATTAAGACACTAAAACCTGAAGAAAGCTCAATGAATGGACAAAATGTATAAAAAAAATAGGAAAAAAAATTGCAAATATCTTCATTACTTTCCGAAAATATTAACATCCCAAAAATATTATCGGCCTCATAGATTTCCATTTGAAAAAATTCAATTGAGTATCATACTGAAAAATAGTTGGCAAATTGATAAAATTTAAATGAACACTAGTCAACGAATTCTTTTACCGAAGCCGAATGTAGAAATTATGATGATTTGAAGAAATGGGTAGTTTTCAATTTTCATTCATTGAGAAGGCCATCGATATAGTTCTCAGTTTTTTGATTTCTTGAAATGCTCCATCAATTTTTATCAACACCAATAGCTCCGAAGGTACTATCATAAGACATAGAATTTGAAGAACCCAGTACACTGCCTGGCTGGAAAAAGGGAAGGCTTTCAGTGGAATTATTTTGATATAATTTTCGTGTGAAAACGAATATTTTAGAACTTTCAACTTAACTATTAACTTACATTAGTGTTTACCAAATTTTTTTAGGTAATCAGTTCATAAAAAAATGTTATGATTGTTATTGAAAATTTGTATTTTATTGAATGTTGAAACGATATTCATCGAAAATATTTACGTTTTATTCAAAGAGTGGAAATTATGTTTTACTCTAGGTAACTGTATTGATGTATTCATGAAGTTATTCCAATAAATAGAAGAAGTG
>TRINITY_DN36_c0_g1
GGCCTACAAGAAAAACTACGTCTATGGCAAGGTTAATTATATAGGTTTTGGCTACTATCGCTTATATGACTTACATCTCAGTGATCGTTAGCGAAACCTACTTAAGTCATAAAGCTCTCATTCCTACTCAGGTGTATGCCATGATGAATTTAAAGTTGACAATAATTTCATCACATTCAGATGATAGATCAACTATTCAAATTTGGAGAACCTTTCTTCCATGATTTTCAATACTGACTTCCAAGCTTTGTACACCCATAAGTCGACACCAGTTTCCAGAGGTTTGTAGATCAATTATCTTCTTCGGTTGAAGTTACTTTCCCTTGAAGTCATTGCCTTCTTCGCGTCTCAAACAAGAAATTCTTCCAACATCATTCAGCATCTCAGGAGTGATCCACCTAATTTAATTTTTGCAATAACAAAATGTAGAAAAAAAATTATGAATATTGATGAAGTAGATGTTCAAAGTCGCGAACGCCTCGGCAGCATCCTTACCTCAATCAAGAAATTCTTCCAACATTATTCAACATCTCAGGAGTGATCGACCTAATTTAATTTTTGCAATAATCTTGAAAGCAATAATATCTCTGAATAGATAATGAAGATATCTTTCAAACGATGTGTCTCAAGCGTATACAATAGATAAGGAAGAGATCTTTGAAACGATGTGTCTCAAGCGTATACTTCCTATGTGAAAAGGGTTGATGATGGGGTACGCATTTTCACGAAGAAGAGTGACAATTTAAAATTTAAATTTGACGTGTTTGTGTCAAAATTAGATATGAGTTTTAGATTTAATTAAATTGAAATTGAATTAATGTAAATTTGAACCTATACGAAAATAAAAATCTTATTACAGGGG
>TRINITY_DN165_c0_g1
GGTATATAGAGTTATAATTATTTCAAGCTTTGTGTAAAATAACGTGCTGATACTGTTTTCAGATCCAAAGTAGCAAATCGAAAACAAAAATTAGAAAAATGTTGGCGTGAAGTAGGGATTTTTTTGAGTGCTCTTCTTGCGCTAATTGCAGCCTTGGAGACCACATTCATGCCTCTTTAAAGTTATAAATAAACCTCCAGGTTTTAAAATGACTTTTTTTCTGACTGAAAATCCAAATTCTC
>TRINITY_DN62_c0_g1
CCATTAAAAATGGATTGACGAACTACAACATCTATTCCGTTTTTAGCTGCTGTTCCAAGTTTGTCCAACCATATGAAACATGCAATGAATTTGTCAGAATACTTGGGGGAACCCCCACCCCATGCTGATGCAGTCTCACCTAACCAAATCTTTTTAGATGTCGAATTTGTTTTTTTCTGAATAAATTTCACGACATCGATCTGCCATTTCAGAATATCAAAGATTACAGGATCGAGAAAGTTTGATTGGTTTGCTGTTCTTCCATTGAAATAATATTGGTGCCAACTAATAATATCAATAGCAAAT
>TRINITY_DN6_c0_g1
TGGAGTAGGTGATGACCCAGTTACAGAAGTCTGTATTTCCGGGGCAAAGCGATTCTGCAATGGTGGAGCTAAATTGGGGAAATTGTTGGGGTTATTAGGGGAATTGCGCTGTCCGTATTCTTTATCGGAAGGCTCTAAGCCTAGAGAATATTCATGATCCGGGATGGTTTCGCCTAGTCCGTAATATTGTTCATTGAGTTCGAGAATTTGGTCCCAG
>TRINITY_DN143_c0_g1
AAAACTCCTCACAAATGGGGCAAATTGAGCGTGAGTCAACATGTAATGAATGGTGTATTTATCACTATCTATATTGGGTGCAGAAAATTATTCTAGCCGCAGGGATCCAACGGCAATTGGAAAATGTGTCGGGGTTGTCAGTAAAAGTTGGGTTTGAGGGAGATTGCTATAATCAAGATGTCCATGGCTGGATAGTTATAGGGTGGGATGGTAGAGTGAGTAATATACCGGCACAGAAAAAGTGGTCTTCGCCTTGTCTGATTCTCGACCCCCAGACGTCAGAAGGATTGGAATCATGGGGCGACGATTTGATATAGACTTAATGTCCAGATAGGA
>TRINITY_DN114_c6_g1
AGTCTCTACCCATGTTTGTCATCTTGAAAGGTATTTTGAAGCTGTTGTGTGTCATAAGAGTTCCCAAGTCGTACTTGGGCTCCAAAATGGGTTCGAAAAGTATGCAAGATCCAATTCCGAAGGCCGATACATGAACCTTCAAGGGATCCATGCTGTTGACGATGTTCAGAATGAGGATGCTCGTGTACTTCGCTATATAGGTCAAGAAAATGGAAATATCCACTTCTAATTTCTCAGAAGCCTCCAGTTTGAACTCGTTGGGATTCACATGAAAAGTCGGATTGGCCACTTGAATTGATATATAGGCTGGTACTGGAGAATCATTCATAACGTTCAATTTTCGTGAGTGCCATTTGAGAAGTGGTACATGGCTGAATTTAATCTCCTCGGGATTCACACAAATCACAGGGCCTTGGACGTCACATGTCAGTTTACAGAGATCGTTAGGAGCACTGCCAAACACTGTAAAATTTAAGTGCTTTGAATGAAGTCCTAGCTGCAGTCCCTTGATCTCCAGGTGAATCGTTATTTCTTCTCCAGGCTGAATGTACGATTCTGTTAAGGATAACTTGCAGGAGAGACCATCATCTTCGTCCTGTAAAAACTTTTTTGTCTTCTCCCTTAATGGATTTACTACGTATTTATGTTACCGTATCATTGTAGAGTATGTAGCCAGGTACTTCACTCATGTTTCTGATTGTAAACATTCTGTCGTAAGGGCAGTTTATGAAGCAGTATCTTATGTCCAATCTAGGCGGCGAACATTCGACAGTAGGTACTATACAATTGTAATATATGGGCAGTTCTACGTAATGTTTTCTAGAGCCCCACATATAGGTATGCAGATATGTAGAATGTCTTGAAGGCTTATTAGGTACCAAAGTAATTTTTATCGTGATGGAGGAATTCCCTGCAACTGTAGCTTCATCTGGACAGATACTGAATTCTTTAGGCATTTTGCTAACTGACGTTTCATCGTGAGTCATTGAAAAGTTCA
>TRINITY_DN48_c0_g1
AAATTTGAGGCAAAGTCAGCGACATCTCTGAATTGCCAATTGCAAATAATAGTCATGAATAATTGCTTCGATATGTGGAAGCTTGGTTTGAATGCATTTGCTTTTGGCGCAACTGTATGCCTAGAAGGCCTACCTGTTCACGTGTCCCCGAATAAAAAGGAGATAGCTTATTCTCTGAACTATGGGCCAGTAAGCAAGAATGAATTGTACAAGATTCGTTTCAAGGTGAAGAACATTACGAACGACATCTACAGGTTCGAGTTCCATCCAATACAGGAATTGATATTTTCACCTAGGATAGGACATCTTTATGGTGAATCGGAGAAAACTATCATAGGCGCTTTCAGAACTAAACGCCACATCGATTTCACCGAGAAGGAGCTCTTTTTGACCATTACCAAAATTAAGCTACATCCTGGTCATATCTTTCCACTACCATGGGATGACCGTCAGAATGCTAACTTGGCGAAATTTAAATTTCA
>TRINITY_DN92_c0_g1
GAGAAATTAAGGATTTTTTTGTCTATTGGGAACATTATCTTTTTAGTCGGGGAAAACAGACAAGCTTCATGCTATCGTGCACAGTAGAGATATGCTATCGTGCACAGTAGAGATAATAGGGAAAACAGACAAGCTTTATCGTGCACAGTAGAGATAATACAAACACAAACAAATTGAGAATACAAACACAAACAAATTGAGAATTTACGAAGTGTTGGAAGTCAGAAATGGAAACATACTAAGTCAGAAATGGAAACATACTCAAAAATTTTCCCTGATGAAAATAATCATCTCAGAGTAAAGATGGAAATGGGAGTTGATGAAAATAATCATCACAGAGTAAAGATGGAAATGGGAGAAGCTGATGATAGCTATGAAAAAGGAAACTCATTTGACTTGGAATACACCGAATACTTTCTTTTCATCGATAAACTCGAAAAACAGAACATTAAACAATAGAAACTGGTACTCGTTAATATTGAAATTCTATGAATACTTTTCATTGATAAACACGAATAACAGAACAGGATAGGAAAGAAACTGGTATTCGTTAATATTGAAATTCTATGCGGACTTGGAATACACCGAATACTTTTCATCGATAAACACGAAAAACGGAGCATAAAACTATAGAAACTGGTACACATTAATATTGAAATTCTATGCGGTTAACAGAACATAAAACGAAAGAAACTGCTACTCGTTAATATTGAAATTCTATGCGCTGCATGCGAACTTCATTATTTTAGTGCATGCGAACTTCGTTATTTTAACTAAGAGCTTAGTTATTATTTTAACTAAGAGCTTAGTTTTTAGTTAAAAGTTGATCAACTTTCTAGTGCTAGTGTTAATTCTTAGTCCTTAGGTAAAATGCATAAACGCCCTCATTGATTTGTTAGCGTTCAATTCTTAAGTTTAATCTTAGTCCTTAGTTCTTAGGAAATTAGTACTTAGGTAAAATGTATAAACATCCTCATTGATTTGTTAGAGTTCAATTCTTAGGTTAAGTCTTAGTCCTTAGTTCTTAGGAATGGTGCATGAACCAACCCTTAATTTCTTGATTTTAATGAAAAATGTCAGAATATGTTGACCATCTCTTTTTTTCCGAATAATGTAAAATATTTAGATACAATTCAATAATAGAGAAGAAAAGAGAAAAGATTAATTTCTTGATTTCAATGAAAAATCTCGGAATGTGGACCATCTCTTTTGTTCCAAATAATGTAAAATATTTATATACAATTTAATAATAGAGAAAGAAAGAGAAAAATTTATTGATGGCCATCGTTCTGAGGTCCTTCAGCCTATTACACTGCATATACATAAATATTTAAGAAAAAAAATATTATAATTTGTTTTCTAATGCTCTAAATAAAGTCTGTGTAGGGG
>TRINITY_DN128_c0_g1
CGTGCAGCTTCTTCTTCTGTCAATTCGGGTTCTGCGGTCTGTTCTTCTACTCCTAGAAATTCAAAGGGTGATAAATTGAGAGAAATATTATCTATATGTTCATTGAAAGGGAATATACTAACTGAAAAAGAAACTGCAACACCCAGAAGGAGCTGTTTAAATTAAAAAATTTTTTTTTGGTAAAACATAGATAGTATAAAAATGCATGAAGGTATTTTTATATGAACAATTTTTGTTTCTTAAATATTG
>TRINITY_DN5_c0_g1
TATTTGGCTATGAAGTGGATGCTCGCTTATTCCGATGGGCGGGCTCCGTCGTGGGCGCGGTTATGGCATTGGGCCCTGTGCTGTCCTTGCATGATTGCCAAACCAATCTGGCGGTAAGCAACCCAGATCCATCTGGTAATTACCTTATCAAACCACGACTACCTGCCAATCTCACCTGCGCTGAATTTCATCAACACGTCAAGGG
>TRINITY_DN64_c0_g1
TTTATATCTTTATTATCATCGACCAATATGTACGAAACTCACTTCACTCTTTCTTATCCTATGCCTTGCATCAGTACACTGAGTATCCCTGAGCATCCTTTCAAACAGATTCGAAGTAATTCTTGGTTTTCAAGTAGTTTTCTGGCCTCATTTATTTGTTAGTAATCTAAACAATGCTCTTGAACACAAGTCAAGAGGAGTTTTTTTCTCTGCATTTCTAACATCCAAGCTTGCCCCATGATCTACTAATAACTTGGCTTCTCTTTGTCTGTCTTCTTCGCATGCTAAATGCAAAGGTGTATTACCATATGAATCTCTCGGATCAACATCAAGATCCTCAAAGGTAAGTAAAAATTCAACTATGTTTGTGTTTCCTTTTGAAGCAGCCCTGTGTAAAGGCGTTGCACTTCTGACATCTGCAATGTTTATGTCTGCTTGGTTTTCAAGTAGTTTTCTGCAAATCTAAAAGGTTCATTACACTCTCTGTGAATGATCTATTTATATTTAATACCTCGAGCCATCCTTTAGAAGCTGCGAGCCATCCTTTAGAAGCTGCATATTGAAGAGCTGAATGACCACCAGAAGTCTTTTGATTTACATCACATCGGTTTTTTATGAGAAGACAAACCACTTCATAATGCCCTGCTGAACTGGAAAGAATAAGTGGTGAGTTATCAGTATCATCTAAGGCATCGACTGGAGATCCCAATTCAATTAGATGTGTTACTAATTTCACATTTCCTCCAACACAAGCCCAATGAAGAAGTATTCTTTTATTCTCATCTTGCTTATTTAATAAAGTTGGATCCTCCTCCAACTTATTTCTGACAACATCAAAGTCACCTTTATGAGCTGACTCAAAAATGGAAGTTTGTTGAGACATAACTATATTGATGCGAATGGAAGTATTTCCCAAAACTTTTTTTTCAAAACATTCAAAATTCAAACGATGATTTGACAACTAT
>TRINITY_DN71_c0_g1
TCTTCGTGCGAAATATCTTGTTGATCACTTGATCAGAACCATAGAAACTCTGTTACCACAGAACTGACGTTGAGTTGAGATTTTGGGTATTGATATAAAATAGCAATGCTAAGCTCCTCGCCAAATTTCAAGCTTATCGCATAATGAGAACCATAAAAAATTAACCATAGAAAATTCAAGAAGAATATTGGATATTAAAAACTTGATATCTCTGTGATTACAGATCTGATCAGATGGAGATTTCGCGTGTATACATAAAATGATCATTCGAGACTGCGTGCACAATTTCGTGCGGATAGCATAAACAGAACAATAGAAAATTCAAGAAGAATTAAAAAAATGTACACCTAATATATAAGTTACAACAAATTTGCTCGAGTTGAAATTTTGCCTGAATATATAAATTATCAATTTTGATCTTCATGCAAAATTTCGTGTGAATAGAGGCTTCTACATAAAATTCAAGCAGAATATTGAAAATATTAAAGTCCGGCTTGAAAAGACTCCTCGGGGTCGGTATAGAGATGATTCAGATATAGGTACATCTTTTTAATGTTGAATTTCGGGACCGTAACCAGATGTCTTCAATCCATATAGTGAATTCTCCAGTTATCGGCAATACAAGGGTTGTAAATAAATGTTTACACCACGTCTGGTGTTTTCTTCAAGATGTGGATGATGATATTCCCCCTCTTATCGAATTTTTGCTGCAAGAGCCCTAGTACAGCGTTGCCGTTCGTACGATAAGATCCCTATATGTATATGTAGTGTTCTGTCACAGACTGTCACAGACTAGTAATCTGTGTAGTAATCTGTGGTTCTGTGGTGATCCCCCTTTGAATCTCCATACCAGCGTTGCCGTTCGTACGATAATTATCGTTTTGTACGATAATTTGCTGCTCAATTCTATGTACGATATCGCATGTACGGCTATGTACGATATCGCATGTACGATAATAGCGTTTTGTACGATAATTTCAGTGTACCTATCATTTGAGCTAAAGTGTCAATAGATACTCAAAATATAATGAAACTCAGTATGACCAGATTTAGTTGATATCCAATTTTTCAGTAGATTATTGCATTTTCAGGAAGTTTTTAATAGGAAGAAATCATTTGATAGATTTTAGTAGTTTCAAAAAATCTAACCGAGACGGTTGGGAATGTCTAGACTCAAGAATGTTCCGATGAATCAATTCATATTCAATATAATATACTTTTCAATTGAAAAGGGCGTATCTCAAAGTGGATATACAAAGGATAATAATAAATCTCGAAAATAGACGTGCTCGTAGGGAAATAAAAATAATTATCTTGAAAGCGATAATAAACTAATAAACTCTGAAGGGTGCGATTTTCGACTGCCTTGAAGATTTCAAAGGAAAGTAAAATGATTATTGGTTCATTTTTATGGAATTTTTACGAAGATATATCTCTGTATTTCCAATCAATTATTTAGATTCATAATATTTTATATGTGGTTATGGGAGCAAATGTTCAATTGTAAAATCGTTTTTTTGATGACCCTTATTTTATAGAGAATTTTTACGAAGATATTTCTTCGTATTTCCAATCAATTCAAGTATTTAGATTCATATTATTTTATAATATGTGGATATGGGAGCAAATGTTCAATTGTTGAAAGCACATTAAAAAGACCATCAAAAATATAATATACGTTTCAATTGAAAAGGGCGTATCTGCAAAATAGCACATTTGGGATATTTGTCTTTGAAGACTTTCATTTCATCCACAGATTCAATTGAATTAATATGAAGAAAAAATAAATGATAATGCATGTTAATTAAATTTAATCTGTGGATGGCACAAATGAAAGTATTTAAAGTTCAATCAATATCCCAAAAGTGATTTTTTGTAGATACGCACGCACTTCTCAATTCAAACGTCAGTATAGATTCATCATATTCCAATCTGATCACGCTGATGAAACTGTTGAAATGATGTTCGATCAATACATTGCTTTCCGGAAATAAAGAGGATCTTATACGAATTCAATACAGTAATTACAATATCTTATGCATAATGGACCTGTACTTAGCAACTCTCATGCTTGTAGACACCTCTGATAATGCTTTGTCGGCATTATCCATAACAGAATTACGGTTCGTTTTATGGGTCGGCTTTAAAATTCAGTAAAGACGGATAACTTTTTTGACCGTTATGCAAATTTAGGTAGCTATTATTTGAAAGCGTTGAATATTTTGCAATAACCTGGACCACTTTAGGAATCACTGGCCTGGCGTATACCGATGACGAATACAAAAATCACATTTGGCAAAACCAGAGGCAACGCCGACAAAGTGGATATACAAAGGATAATAATAAATCTCGAAAATAGACGTGCTCGTAGGGAAATAAAAATAATTATCTTGAAAGCGATAATAAACTAATAAACTCTGAAGGGTGCGATTTTCGACTGCCTTGAAGATTTCAAAGGAAAGTAAAATGATTATTGGTTCATTTTTATGGAAAAAAATTTCGTTTTTCGTTTCTGCAAGAATTCTGAAATTTCATATTTTGAAAATCTTGGGAGGGGTAATTACTATATAATACTAGTACTCTTCACTATTTCTATACGGTCTTGCTTACTGACTGACTGATATTTGTACGTTTTTGAGACTCAATTATTAAGTGAAGTTAGTGAAGGTGTTTGAAGTTTTTTTATAAGTTATATTTGCCTTTGACCTAAGGACTTTTTGTTTATTCAGTTATTAAAGGTAAG
>TRINITY_DN71_c0_g2
AAAATCATAAAACTTCTTTGGTGCCTGTCAGCTGAAAATAAATACAAAGAATCATGGAATATCCGAACTCCGGAGGGACGAAGGGTCCTCATTAAAAACAGATGGTGTTCAAAATTCAGTTCAAAATATACCAATTACCATTATCTCTCATTTGGTATTCTGTTTAGTGAAAAACAATTGTTGTAACTGGAATTTAATTGACAAATTTGTGTGGCTGAATATTTCAGATTTGAATATATTCATTTCATATAAGAAAATCGTTTTTTTTATGACATTTATTTTATAGAGAATTTTTACG
>TRINITY_DN71_c0_g3
AATCTGTGGATGGCACAAATGAAAGTATTTGAAGTTCAATATCCCAAGAGTGATCCTTTGTAAATACTCACGCATTTCTCAATTCAAACGGCAGTATCGATAATCATGAATCGAATTTATTAATTTTAATTCAAGAAGACTATTGAAGTCAAATATAATTATCGAAATAATTTTTGTTACTTGAAATCGTAGGTACTTACATATTTTAAC
>TRINITY_DN108_c0_g1
TTAATATTGATCATAATTATTATCAATTAATATTATTAATATTAATTTTGCAAAAAATTCATAGGTCAAATAGACTGAATCTGAATTTCAGTTCTATATCTAAAAATATCTCGTAAGTGACTTCTGAAAAACAGCAGATACCAAAATGTGCGTCGTGCTATGTAATTTTCTCCCAAAACCCTTAGTAAAATTATTCATAGTACCCATACAAAGACGTTTTCATGCAGGAGCACATCGATAAACTCCATAATGTTGAAATATTGTCTGATTAGTTGTAGATTGTAGATGTTAATTTGTTGAAATAATATAATGTGATTTGATTATTTACAATGAAGTATTGGTGTGAATCAATCTCACAATCAAGTACGATGAAATTACTGTTGATTTCAATTTTATGTGTAGCAGGAACATTTTCTGCACCAGTAGTAGATGAAGATGTTAGAATATTAGAAAATAATGATATTGGAAATTTCAATGAAATCAGGGAAAATGTTCCTAAAGGAATAAAAAAATTAGATCTGCCAAAATCAACTTCCATTCAAACATTTGAAGAAGTAGAACGAATCACTAAAATTTGTATGGAAGAAACAAAAGTCGATAAAAATATTGTCAGTAAGGTTTTAACTGATTATATTATTCCCGACGATTCAAAATATGGAAAATTCCTCGCCTGCAGTTATAGAAAACAGAAATATTTGAATGAAAAAGGAGAAATCCAGTTTGAAAATATAATGAGATTTCTATCTAGATATTATAAAAAAGAAGACTTGGAGGTTTTGAAAGTTTGTGGAGAGTTGAAGCAAACTGATAATGGTGCTGATAATGCTTTAAATACTTTGAAATGTATTCTACCCAAGCTTTTACCTATTCAAGAAATATTCAATGAATAAAAAAATTGAGCTCTAATCTATTTAATTGTAAAAATATAAATCAAAAAACTATATTAACACACAAATGGTTGTTGGAGACTATATTTTATGATCTAAATATCCTCATGTTGTGGAATAAAACTAACAATTATATAATTAAAAAATAGTTTTTATTGTTGTTTATCCAATAATTTATATTTTTCGTCCAATGATTATTTACAATGAAGTATTGACTTTACTTATGCACGTATTAGTTTCCTCCATATTCCCCCACACCTGTAATGAAAACAATATTTTTCAAGATCTTGTGGTATTTCATGGCAAAATACAAGCTAAATAGGAAAAAATTGACATGACTTCAACCACCTTTGGTCCCAAGCTCTGATAGCAGCAGTTCTAGTAACGGAAGCAAACCCTGCAGAATTTCCACATCTCACACATTGTTTGATGATTCGTGGTGTCTTTCCTAAGAACAGATGACGGATCGAGTCCACTGTCTGGTTGAAGCTTACTTCATCCTTTTTAACTAAATAATAAGGCTCGCAGCCATACTCCAACTAAAAACAAATTTTATTTAAATATAATACTAGATAGTTCACAATATCGTGCGTCTGTAAAGTCTGATGACCATCAATTGCCAAACAATAGTCTTTCTTCGATACTTCTTCAAACAGCTTTAGAATTATCAAGTGATATTTGACTACATTCTCCCTCAAGTACTGCTATATTATCCAGTCGTGTAGACGTTTGATTTCAAATTACCCCAAAGAAATAAATCAAATGGAGTTAAATCTGGTGATTGAGATGTCCATTCTATTGACATTTCTCACCTATCCTTCTCTTTAGAAACAGTTCATTGAGAAAATCTTTCACTTGTAGAGAATAATAAGAAAGAGCATGATCTTGTTGTACGACACAACCGATTGGCATTAGACTTTTGGACGCACGGTATAATGTTTATGAAAACATATTTAATAGCATCAATTGCAATGGTTACCTGTAATGGTAGTATTTGTTGAGGTAATGGTAGTATTTGTTGAGCCAATAAAGGTGAAACTAAAGCTGATTTGTACACTGGAAGCTGCATTGGCTGCACCATTACTTGACTTGCAAGCTGACAACAATCGTCTAAGAAATAGGAAATAATGTTAATGATGAGGAATACACAAGGCAAGTTTCAGGATTTTATGAATTTTGTTATTTTTTTTTTTGATTTTCCTTCTATCCATAGATTGTAATAAAGAGCAAATTATTTTTATTATTTCTATCAAGTTCTCTTTTCTCCCTGAATATTGATTTTCAACTAGTGCTATTCTGGAGTAAATAAAAAGATTCAGAAATATTCTGGATCTTTTGAAGTAATTTAAATCATGAATTTAGTAAAGGAATATCAGAAAAAATGGGTTTAAGTAATTTAGCCATTTATTTGCGCACTTTAATCAAACTCTCATCTGGTTCGTTCACATTCTGTACTAATCTAGTCAATAACCTAAACACTAGTGCCAAGATATCCAAATTGGCATCTGACTTGACGAAATGAGGAAGACAGGCAGGTCGAAGAAGGCCCCATATTCTGATGAGAATAAGCATCTCCCTCAACATATTCAGTGCTTTTACATCTCTTATCAGCTCGTAACCCTTTGATTGAGAAGGTCTGCTTTCTGGAATTTTAAGCAATAAATTGATTGCCAAATCCCCTATCCATTGGATTAGCTGCTGAAGACTCTGCAATGTTGTGGGTTCCACTGTAAATTCTTTCGCTTCTAAATGCATAAGGAGTTTATCAACATCACATTGGCCTTCGTTGATCACGTTAGAAAGAGAGTCTGCAGGACTTTTTTCATGGCTGCTCATCTCACTTGGTCGTAAAAGGCTCTTGAAAGCTGTAGATATGCTATGCAACATAGAGAAGTGAGTTAAATCATTAGCTTTGCACTGTCCTTGGGTACTTAATCTGGAAAAAAGTACAGAAATTCACTAGTGTTAAAATTACATAACTTTTCATACAAAGACGTTTTCATGCACAAATATTCCACATAATAATATTGTTGCAAGGCAGAAGGCTGCCGATTGAAACTTTCTGTCAACCTATCACACAATGGATCCAGCATGCTAGGTCTTAGAACCAGCAGAAGATCAAGCCAGTCCATTCCAGTCACTAAACAGTATTCCAGTATCGTGGTGCAATAAGGCACACTTAGAGGAGTAGAACTATCGATTTGAGGGGGCAACTTGAAGAGATACATAGTATCGTCGGAGTCGATTACTATTAGAATGTTGCCAAGCCATGACATATCCATTGTTGCAATATTAGTGCTGACTTTTTGGTATTTAGAATAATGTTCCCCCGTATACTTAGGTTTCAGTGACAAGGTTGTATTGGCAACAGGTTTAAGTGTATCGCGATACAAACAATGAATTGAATTATCTTTGTAAGCTACAACTATGTAGCCACTAGAAACGTTGTTCATTAGTGAGAGTTTACTTATCACTAACGAAGAAATTCCATGGGGATATTGAAAATGACAATGGTACTGCCACAGAACTGTATGATGATGTTGAGCAGTGTCACTTTTGCCCAAAACACTATGTACAGGCATTGACACTTCAATCAATTCCCATACTTGGAGCGTAGTTATAGTATCATTTCCTGCAGAGACCACTAAAGAATCTGCATCTTCCCTCATCAGCCATCTAACATTGGTAACTGCTCCATTAGTGTTAAGTATGTTTTTTATTCCTGTTTCTGGTGGAGCTTCGGATAAAAAGAAACTAAGAAGTGATTTACTAGTAATTACACATTTTTCACCAGATTTCATGACTGAGACATTGTAACACATGATGGGCAAATGGCAATTCCCACTGCTTACAGCCACAAGGAAATGTCCATTTTTACCGTAACAAATATCTGCAGTTTTGACTAATGTCCTTATTGGGGCCAAGCTCTCAGTGGCAATTATAACTGAGGTTTGACTAGTTGTCTGAGGGAATAACATAGCACAAAGCATGCCCGTTGAAGTTAATATTAATGCTCCATTGCAAGGTCTACCTCCAAACTGTTTCACTGAGCATGCAAATTTAACATTGGTGAATTTATCTGTATATACCAAACTATCTTTTTTCTCAGGATTAATACATATTTTTTTTCCAGTATGAAAAAAAGCTGTAGTTATGATATTCTCCCCTTCTAGATGTGTATGAGCAACAATTATCCATTCATTGAGCAAGTGATCCTTTTCTTTGTAGACTCTAACAAAACCATTCTGATCAGCCACTAATAATAACTCCCCAGTGGAATCCCATTGAAGGACAGTCAGTGTTGAAGAATTTGAAAGAATTCTGTGATACCAAGTAATACATTACTGAAATGATATATCACAAAATAAATAACATACTTGCAAATCAACCATGGATTATTTTGCAAATCAACCATGGATTATTTAAGTCTGCAATATAGACATTGGATGACCAACTCGACGATTTGGAATTTTCTAAATCACTTTCTGTACAGAAAGCTATAACATTTGTAGGAGAAATAGAACACCTTATCGATTTAGTCAAACTGAAAAACAATGTTTATAAATCTTTAGATTCGCCACAAATTTGAAAATTATTTACCAGTAAAATATGTTTTCCTTATGAGTAAAATATGTTTTCCTTATGAGAGCTAATTCTTTTACTACTTTTACTTAGAGTGTATATGTGATCCATAATGAAGCATCAATAAAATTCTTATTAAAATTCTAAGTTTTTTAAGATTTTTAATTACAACAATAAACGATTTCAAAAGAGGCTATGTACAATTTTTGAC
>TRINITY_DN127_c0_g1
ATACTCATTTTAAAACTCTCAATAAACTAATATCAAATTTTCTATACATTTTTCAAATAAATTTCCAAAAAATAAATCTCATCACAAATACAAAATACAATAACCTAAAAATAATTCATTATAAAACCCAACTTATTAAAATTATTTCAACATTTTCAAATTCTCATTACTAAAAAATTTAATTTAAATATATAATCATAACTAAATTCCAATAATTTTAAAAATTTATAAATCTCACAACAAAAAT
>TRINITY_DN135_c0_g1
TGGGCAAGAAGAATCAAAATGACGAAGGTGAACATAATGAGCAAGGTAAAGACGAGAGTAGAGGAAGAAGAGGACTTCCGAGTAGGGAAACGAGATTGCCTGTGCTTCGCCATGGAAACAAAAACCCTTTGAAGCAAGATCTGGAATTACAGAGGCTCGTTTGAATGAGAGTATCGATTGTTGTTTGGTCTTCGTCTCCACAGTCCAAGGCCTCTCTCTCTCTCTCCCTCTCTGGAAAACTTGAAGAACTTTGACACCGTAATTAAAGATTGATTTTTG
>TRINITY_DN43_c0_g1
AAACTCCAAAAAACTTATCTTTAAGAGGCGTTTTATGATATCTACACAAATATTATTCTACGTATTTTCCAATTATAGGCTCGATCAACACTTAAAATGATTCATTTGTTGAGAAACTCTTTTATTATCACTTAATCTATATTTTTTCAAGATTGGATTATCTAATAGTATAAATAGCTAAGTCAGGTAAAGGTGTCCTCAGAGGTATTTTTGAAAGATACAACTGAAAATGTGCGACGATCATCACCACCACCACGATCACCATGATCATCATCACCACCATGATCACCACGATCATCACCATCATGTCCCACCACCACCAGATCCGTGTGTGCACATAGAAACATATACTGATGGTCCACCACGATGCTTTTATCGTATTACATAATAAAATTCATGAAAAAAAAAAATTATCTGAGATTGTTCTACCGATGAGATCACATTCTATATAATGAAGAATAACTACATGTTTATTCTATGCACATTTCGAATTTACAGAAAAAAAAATTATTGAATTATCATAGATTATTTCTTTTTGCTTTATGATTAATAAAAAAAAAATATTTTTTGCAGATACTGATGGTCCACCACGATGCTGGGAGGACAACTGCCAAAACAGAGAATGCCGTTATCATTACGGGCATCATAACCAACACCACCACCATAATTGTTGAGAAGACTCGCAATAAAGATATTTTATGTAAATTTTCAATTAGGGAAATAATATCAATGTTTCTATCTATTCTTTTCAGTAAACTGTAAATTTACTCAATAAATATCAAACCAAA
>TRINITY_DN46_c0_g1
AAAGTAGTGTAACGAAATCGCAAGCCCTACGCTTCTGCCTGCACAAAAGAGGGGGTGTCGACGTAAAGGGCAGTCAGTGCCGTACACTCAAGTAGATATAAATTATGGAAATAAATTAATGTAGTAGTGAAAATAAATTAATGTAATAGTTGAAATAAATTATATGTAAATAGTTGTTTATGGTTGTGTATCGGAAATAAATTAGTGTCAGTAAGAATTACCGATTTAATTAACCGAAAAACGTAACAATAGTTTGGTGCAAGAGACCCTAGTATTGTTCAACACATTTCTTTGTGTCACAAGATTAGTTTTCACTTTACAAAGTAGATAAAGTGCAAAATAGTTGGATGCAATAGGCCTCTGGACATGAAAATATTATTTTGTCAAGATTAATGGACATTAAAGTAAAGTCATAAAAATATTATTTTGTCAAGATTATTGATCAAAATTAAAATAATTTAGTGTTCCTTTTTTTATGGTTGAATTTAGTACTGAGAACTAAGATCTAATTTCAACCATATAAAAATGGAATATGAAATCATTTTAGTATAGTATATCCAAAGTCACTTGGAGGAAGCTGAATATTTCGATTATACAAGGGTTTTCCAAATTTCTGGAAATTCCTTTGGGGCCAGTAAATTTATTGCCTAACAATACTCTCGAATAAACTCCGGTATTTAGAAGATCG
>TRINITY_DN70_c0_g1
ATGACTTAAAATGATGTAGAGGTAAAGGTAATAAAGGTATGGAATTCTCCTTCTTGAGTCATTACTTCAGTGAATAATGTGTTAAATGGTATAGTTATTAGAACAATTGGCAGCATCCCATTTATCAGTCATAATTGTTTCAAAGTATATGAAAATACTAAATGCATTACTTAAAAACAGTTCAGTGGCGTAACTTGTGTGTGATATGGCATGGATTGATTGATTATAAATTGTTTTGATGCTTCCGATAATGTCTAATGTATCTTATCAGTTTGGTGTTGCTTATAAAAGACGTCACAAGGAAGTATGTCCTCACTCCTAACTGAGCTTCCCTACTGTCCTAACTGCAAGAATCATTCACGACATATCTCTCTATGTGGTATGTGTTGAGACTCAAAACGAACAGTTTTTATCCAGTGGTGTTGCATATTGTTTATTGCAGTTCTTTAGAGCATGGATGAGCTAATATTAGGTTTCAGACATTGTGGATCAATAATTTATTGCTTTCAACTGCCTCAACTATGTCCAATATGTAAAAATGTAGTTAGTTTTTCATGTGATACGCCTTTCAGATTAACATGTGATACGCCTTTCAGATTACCATATCCCTTCGTTAAGGCTCATCAACATCCACTGTCAATTGTTCTGAAATCTACTGAAGGGACGTTTTTAGAACATTACAGCTGCAATGAAGACCTTCACATTGGTATTACCGATTGCAACGAAGACCTACACATTGGTATTACCGATTGCAAAGGCAAAGTATATGAATACGACTCAGATGGTTTAAAGAAGTCTGACGGAGAAGAATGGTTACAATCCATTGTGGTATACGAAAAATCAGAAGACTGGAGTTATGATTGGAGTGAAGCTTTGAGATCAGTAGCTTCTGATCCTGAAGAGTGGAGTTACGATTGGAGTCAAGCCTTGAGATCAGTAGCTTCTGATCCCAAATGGAGATCTGAAAATTATGATGAACAAACCTTGAACTGCTTTTCCTTTGTTACAGAATTTCTTTCAAATTTAAACTGTGTAGAGACTGAAAAAGAACAGTTTTGTGAAGAACGAACAAACCTTGAACTGCTTTTCTTTTGTTACTGAATTTCTTACGAATTTAATTTGTGTAGAGACTAAAAAAGAACAGTTTTGTGAAGAATTCGTTCACAAAAAGATTGTTTCAGTCAAGAAATATATCAAAGTACATAGAAAAATTGTTAAAGATGGATATTGTAGTATAAAAAATGAAAGTACAAAAAGATTGTTTCTCTCAACAAATATATCACAGTGCATAGAAATATTGTTAAAGATGGATATTGTAATATCAAAAATTAATAAAAATTATTTATTAAGTATCAAGAATGATAAGCATGTTTCAAATTTCGTGATACATATAGCGTTTTGCCACCGTTATTTTTGCTTTAATTTTATACATTTTATTTTCACCCAATTACAGAAAAT
>TRINITY_DN96_c0_g3
GCGAATTTGAAATTCGGGAAGGGCACATCAATATCTATATCAATACCATTAATCTTCAAAATTTACGAAAAACTTTCCTTATAACCAAATTACTGAACTATACAGGGTGAGTCTTTGACTTGTACATATATTTCAACCGAATATTCCTCAGGTCAAAGGAAACTTCGAATATTCCTGAGGTCAAAGAAAATTTACGAAAAACTTTCCTTATAACCAAATTACTGAACTATACAGGGTGAGTCTTTGA
>TRINITY_DN176_c0_g1
AAAGCTTCCGAAAGCGATTGAGGCAATCTTTGAAACTTCAAACCCATGTAAGAAGGATTTGTATCAATGGGTTGAGGCAACTGAAGGTGGTAACGAAGGCCATCAAGTCCAGCACAAAGGATCGCTGCTAAACCCAAATATGGATTTGCACAACCATCAAATGATTTTACCTCAAAGTTACTCACTAAAGTAACACCAATTCCAGAGATCGGAAGAGCGTCGTG
>TRINITY_DN110_c0_g4
GCACTTTCCCAGGAAAAAGTCAAGTTAGAAGCGAGATATAAACAAAATCAAATGAACGGAGAATTTGATAGGATAGCGTTTGAAAACAGAGAAGTTAACATTAAAAATTTACGGGAGAAAGTTGCGGATATGCATGAACAAATCAAAGGCAAAGAGACAGATATCGATAACAATAACAGCGTTCTTAATGGTTTGAGAAGTGATCTGCAGAACTTGATAGGAGAATGTGAAAACCTCTTCCAAACTTATGCGCCGAAGA
>TRINITY_DN110_c0_g3
TTTTTCCAATTCTTCTAATCTTTTTCGTTCTGCTTCTTGTCTAGCCTTTTCCCTTCGTTCTATTTCTTCCTCCTTAATTCTCTCTACTTGACTTTTTCCTGGGAAAGTGCCAGAAGCCTTGCATTCTGTTCCTTGAGTCTATTCTTCAATTGAGACATCTCTTGCATTTGAGAATCTCTGGTGGTTCTCATACCATCAATTGTAGATTTAACGTTGGAGACGCCTAATCGAGTGTCGCATATTTTTTGTGATAAATCTTTCACTTGTTCATTGAGGGTGCTCAATTCTATTGTTAGGCTTTGATTCTTAGCTTTGAGCTTCAAAACATTCTCTTGTTCTCGTTGCCTTTGTTGTTGTAACTCTTGCAGTCGCTGCTTTTCCCACTCAAGTTGTCTCTGACGTTCCATTTCTTTTCTAGCTGCTTCTCTCTGCTCTGCCTGTCTTTTTCTTTCTTCCTCCTTAATTCTCTCTAGTTCTTGCTGTTCTCTCATCTGTTTTTCCAATTCTTCTAATCTTTTTCGTTCTGCTTCTTGTCTAGCCTTTTCCCTTCGTTCTATTTCTTCCCTTTCTTTTCTTTCCCTTTCCTCTGCCTCTTTTCTCTGTTGATCCAGAAGTTGTTTTCTTCTTCTTTCTAATTCTGCTTGTCCTTTTTCGAAGTTTTCTTTCCTCTTGTCTTCAAATGAAGTTTGAAGAAGAGTCGAAGCAGGATCTAGCTCTGGGGGAGCGCTACCTTGGCTTGAAATTGAAGCTGTCCTGGATAGAGACTTAGTTGTTTTTCTGAAAGTGGGAGGTATCAAGTCTAGTGGCAATTTGGCTGGAATAGGATGTCCTGTAGCTGCTATTTCACATAAATGCATAGCCAGAACGAACTCTTCACAACTCAAACGGCCATCAGCATCCATATCAGATAGAGACCAAATTTGAGCTAAAATATTTTGAGGCAGTTTACTCTGAATCATTATATTCCTAGCTTGAACACCGGATAAAAATCCGCTTCTAGTTCGATCGGTAGTGTTGAACAGTTGAGTATATTTTAATTTTGTTTGATGTGGCACAGTCCACTCTGCCTGAGGTGATTCAACTGGGGCACTCTTATCCAAGCTAGTCACACTTGCTCTTGGAGTACTAGATGCAACAGGACCTTGGGGTATTACTGGAGGCATTACATTGGCTATAACATCTCCAACAGCGGGGACAGGAGCTGCATTAACACCTTTCAATCCTCCGGTCAACAAACCATCACCTGCATTTGTTAGTGGTACGCCCCCAGGAGCAATTGCTCCAGAAATAAGAGGTTGTGGAGGTATTGGAGGTACAGAGCCAACAAGCGGCTGACCCATATTCATTGAACCTGGTAAGACTGCCATGTTAGATTGTATGGTAGTAACAGAGGGTTGGACAGCTCCAATAGGAGGTTGAGCAGCTGGTTGCATTGTTGGCATGATAGGTTGTCTGGGAGGTACAGCTGCAGGAATAGATGGTTGTACCAAAGGTACAGACGGCATTGGAGAAACAATACCAGTAGGCACAACACCTGTAGGTGGATGGAAGTTTCCAATCAATGACTGCTGGGTCACACTATTCTCCATATTAGTTACATTTGCAGTTTTAGTAGTTAAATTTGGTATTAAATTGGGTTGAGGTTGAGACATTGTGTAGAGAGGCATCGTCATTTGTGGAACTTTTGGAGGATCAGGTCTTGGTGGAGCATTAATTAAAGCTGCATTTGGAAGAGGAGGGATAGCTGGAGTAGAAACAGCTTTCAGAGATGCAAGAAGTGTTGGCGGTAGCATTTTTGGAACTTCATAACCACGTAACTTCAGATTAATCAATTTGCATGCTATAGAGAATTCATCAATGTTCATTTTGCCATCTGAATCTGTGTCTGCCAATGCCCAAATTTGTCCCAATATGAGTGGGGGTAACTGAGACTGGAGGAAAAATCCTTTTGCTTGATCTCCTGTGATGATTCCATTGATTGGTTTCAAGGAGCGGAATTGTTCCTCATATCTTATTCTTTCCCTCTGTAAAATTACCCAAGGGTCTGAGGATGGTGTACCGGCGGCAGACATCATTTTGGAATATTTCTTTATTGAGCTGCAATCTGTTCCAAATATTCAACAATTTCGGTAATTACAAAGTTATCATGTCTTCAACTTTTTGCAAAAATCTCCACCTTAAATTTATGCCTATTCTTTCATTTGACAACTTTACAA
>TRINITY_DN110_c0_g2
TGCTATCCTTTTTTAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAATTTATTGATCAATCTCTAGGAATGTTTAAAGCATCTACAATTTCTTCAAATACTTTTGCTGATGACGAGTCTGGGAATTCTGTAATGCAAGGCTTCGCCCCTAGTTTTCCTATTCTGGGATCTATTGGTAAGGTGCCTAAAAGAGGTACATTGACCAGTTCGGCTAAAGATTTACCTCCACCTGTACTGAAAATGTTAGTGCATTCTTTGCATGTTGGACAGACAAATCCGCTCATATTTTCAATCAATCCAAGCACAGAAATGCCTGTTTTTTTACAAAAAGTAATTTCCTTCCTAACATCTTCAATTGAAACTTGCTGTGGGGTGGTAACGATAACTGCTCCATCACATTTAACATCTTTCAAATTTTCCATAATTGTTATATGTTCATCGGATGTTCCCTCCTTCTGACTGGTGCACATTAGAAAACCAAGCACTCATGAATAATTGGGTGATTAACATTTGATGAAGGTTTATATGGATATTTAAAATTTTTGTATTACCTGGAGGGGTATCAATAATCAAGGAGGGGTATCAATAATCAAAAAATCTAAATTGCCCCAACAGACATCAGTGAGAAATTGTTTGACCATAGCGGTTTTTTTTGGACCTCTCCAAACAACCGATGCATTTCTATTATTCAATAAAAATCCGATAGACATTACTGACAACCTTTTTTCGTTGTCTGCATAAACAGGCACCCATCTTACGGAAAAGAAAAATAAATACAAACAAAACAGAACGAAAAGTAAACATACCCTCCTTCTGACTGGTGCACATCCTCCTTCTGACTGGTGCACATCCTTTCCTTCCAATTCTAGTAAATAGGGAACACTAGGGCCACATAAATCTATGTCTAACAGACCTACCTTTAAACCTTTTTCTTTCAGAAAATTTGAATAGTTTTCATGAAAAATCAGGCAAGGACAAAGAATGTCATTACCTTTAAACCTTTTTCTTTCATAGTTAAAGCTAATTGAGTACTTATTGTAGATTTTCCAACACCCCCTTTTCCAGAAAGAATTAAAATTATATGCTTAACACCGTCCAACATGATTGTAGAATAAATTTGGTGATCTCGTAATATTTAATTTTTTTATATCAACACTTGAGAAAATCATGCAAGTTTCGAGTTAGTTTGGTTAGAAT
>TRINITY_DN110_c0_g1
CTTCGTTCAAGTTCTTGTCGAAAGTCTTTTTGAGTTCTTCTGCTTTCTTAGTAGTGTCAGGTCCTACCAATTTTTTCAAAGAATCAGAAGTCTTGGTCAATTCAGCTTCAACAGATTTGAGAAACTTCATTGTCAGCCGGATGTTGTTTCCCAATGCTCTCTATTATGGAATTGACCTGATAACACAACGATTGAATTTGTTTATCCCATTGAGGAAGAGTTTCTCTCGTTTCAAAATGTACAGTTGAATCTAATTGATCGATAGCAGAATCATTTTTCCATGAAGAACCAAAGTGTAGCAATTTTCTTGGACCTAGTTTGTTAATAAATAATCTTAAGATATCATTCAGATATGTGATGAACAAAAATATTGTACCTACATGGTGGAAAGTAGTACTGCATAAAATAGATTAAATATAACAGTTAAGTATTACTATTGATCTTTTTTTTAAAGTTAATTGATAAACAAATAAAAGGGAATTTTTCAGCACATTCCAATCCTTGTGGTTTGTGTCTTTATTGTCTCACGATTCACTATTAAAATATTAAATAAATTGATTTAATAATGGGTAATTATAATTTATCAATCAAAATAATTGATTGATTGTATGAGCTAATTGATTGATTGTATGAGCTTAAGATAGATGTAATGAAGTTTGTTCTGAATGCATTAAGTATATTCTATTTGCAGTCCTCTAAATAGTGTTTTTTTATTGATTATCAATATTCAATGAACTGAAAATAATTAATATTTTTTATAAAACACCTACTAATAAATAATCTTAAAATATCATTCAGATATGTGATGAAATATTTGTACATCAAGTGGAAAGTTTTTTGGATATTTCAATTGAGAAAAGTCATTTTCTTAATTCCTTTTTTCATGCATTGACTAATCTAAAGAATTTGAATTTTTATGAGAGGTTATATTAAATTGCATTGACTAATATAAAGAATTTGAATATTTATGAGAGGTTATATTAAATTTATTACGTGCTTTCTTCAATTTTTGAATAATTGCAAATCCAATTTTATTGTTAATTCGCCAGATTCAGCTTGACGGAGTAGTAATTTCTTTATCAGTGGCCCAGTTGCATTTTCAGTTTCACTCAAAATGTCCAAAATTCTTAACTCGCAGCGACCCAGACAAACATCTGGAGTGTATGCACTAAGTTCAAAAACTTCGAAAGTAACAACTTCTTCATAAATATTTTTTAGATGGAACTGCATAGGGTTATTCCAAAACAGCAAGGACACGGGAGGATTTCCATTAGCTGAACACGAAGTAGATTCCTTTGCTATATCTGTTCGTTGTTCTTGATCGCCGAGAGTAACTTTGCAGAATATATTGTCCACATGATTTTTTCCCGATGAAACAAAATTTTGTCCCCTCTGCACAACGATAAGTAGACGTCCACACGCTGGTCCTATATGAACTTTTGTCTTAGATTTCGTATTATTGAGCTCGGTTTTCTTTTCAATGATTTATACTTGTTGTATCTCCAAGCAGTTAAATTTAGTTCCATAGCTTCTAATATTGTTACACACAGAACTACACCAATTCCATTAATTGTCTTAGATTTTGTATTATTGAGCTCGAATATTTTTGTATATATCAGCCTAGCAGCATCTATATTTTTGGTCCATAAGCTGCATTCATTCACTGTAGGTGCTAATAGTAGAAAAGATAGTTTAGTTGATTCATCTGTTACATTTAATACTCGATTCGAGTCTGTGTTCTTGTCTACGTTATCTGCACTATTCACACTTACTGATAAGTGTTGTATCAATACAGGCTGTTTATAGAGCTTATAGCTATTGTTAGAATTCTTGGGAAATGAAAATTGTACATAAGATGCTTTACTAGGTTGGACTAACATAAACATGTCATTGAATAAAAATGCAATAAGCTCTTTACCACTCTTTAATTTACTAACAACACCAAAGTGTAGTAATTTTCTTGGACCTAGTTTGTTTGTGTTACTATTGAACATAAGATTCAAATCATTTTGTACATTTTTCTGTAACCAGTCCATTCTGTCTAGATTTTCTTTCACTCTTATGTTCTCATTTATGCAATTTAAAAAATCTTCTGCTACTTGTAACGCTTCTTTGAGTCGAGCATAATCTTTGTGATTTTCATTGGTATTCTCCAAAATTTTTCCAATTATTAGGGGATACTTTGTTATTCTTTGCATTGGTTTAATCAAGAATGAAGATAATGGCATTCCTTTAACTGAAGGATCTAATTGCGCTTTTTTAAGGAAATATTTGAAAGCTGTACAATTTTCCAGTAATGTCTGTAGTAACTTTGCGCCATCTAATTCACTGGTATTCTGTAGTAATTTTGCGCCATCTAATTCACTGGTACAAAATGAAATGTACGGAGTGAATCGGGGTAAATGTAAAAGGATAATGTCACCAATAACATCAGCACCTTGGTTTAGTCTTCTTGATAAATCCTTCATAAAGTCTTCATTACATTTGAGGATTTCATCCCAATTCAAAAATATTTGACTAATATCTTTATTTGAGATTACTTTATTCTTCTTCAATGGCTGCTCAAACACTCTACATACAATTGCTAAATCTTCAACGTATACTCTTTCTGTATCAATCAATTCTCTTATACATTCCTGTCTCTGATTTGCTCCGAGCAAAGGAGATTGTTGCTGTAGTGGAGACACACTTCGAAGTCCATTTAATGATGAACAATTACATAAGTATTCGATTTAAAAGATGATTATAGAATTAATAATATGTTTCATTCATTTTCAATGTTTCATTCATTTTCAATATCTAACAGATCTTAAAATAACAACATATGACAATAACATATGACATAAATAAAAAGGGGGATGCTTCGTAGGGTGGATTCATAAATTGTAAGTTATAATGTAAAATGAAATAATCTTATCTTACCATTTAAACACCCACCCTACCAAACACTGAAAGATAAAACAGTATAACAATTATCATAAAAATCTTGAAACAACAACTATATGTACTAAATCAAAATTGTTTCAAGTAAATACAATAATATAAATTAAAATTAAATGAGCAAAATAATAATATAATACTATAGTGAAATGGAATTGATTTCAATATCATTGTTAACATCATAAATAATTTTTTGATAAGGAGTAAAGGTTTCATGAAGACATGTTTGAGTTAATATATATGTCAGTTTTTTAATTTTAATATTTTTCAATCTGAATATCATCAAATTCCTATTACAATAATCGTTGAATTTTTCTTTGGAATGAGTAATAAGTATCGTGAAGACTGAATAAATATAAAAGAAAAATCACGAGATTAATTGAAAAGATCTAACCATTTAATACTTTCTGTTTAAATAACGCTGTTATTTATTATAATATTCTAAGAATTACTTCTCCAATAACAATGAATTATTATAACATGGCAACTCAAACACATTCATAAGAACCCAATTTTCAATTGTATGCTTCTCTCTAAACGTCCAATAGATCAAGTTAACTAAGATTTCTCTAAAAGTTCCTAACTATTCAGCATCACAAGGTAGGATGGGTGCATGGTGCCGTTCCTAGAAATAATGATATAATTTAATAAAAACTAATAATAAACTCATATTTTCTTTTTTTCTCCATATAAGCACTTATAGCATCATAACCCGAATTGAATGAAGTAATATAATAACACTAAATTTTTTTGGTACTGAATTCCTGTAGATAATCTACATCAACCTATTCTATTCTTGCCAAAAGTATTTCTTAAGTAATGATAATAAAAAAGAAATCAACAAATATTGTTGCTGTAGTGGAGACACATAATTACTAGGAAATAAGCCGGATACACCATTCAACTCTCCTCTCCACCAGGCTTCTTCTTCCCTGGCCGTTACGCTAATAATGTCATCCTTATTAAAGGATAATTCGTCTGGATTACCGGCAGTATAAGGGTACAAGGCAATAACTTTATCAATTACAACTTCTTGTTGGATCCTTGTAGTTGAAACTGGAGTAGTTCTGCCACTTGCCCTTCCACTGCTGTTCAAAATTTTAACGTAACTGGCAGGAAACCATCCCACCTGTCTCTTTCTACCCTTCGCTTGCAATTCACCTTCCCACCAACCAGAATCGGTCTTTTTCCGAATCATGATCAGTTGACCCCTTTGCAAAGAGAGCTGTTCCTGACTAGTAGCTTGATATGGAGCAATAACTGACGCAATTTCTGGTTTCTTTGTTTTGACAATCTGTGCGCTGGCCGACTTGACAATATTGACCTTCTGTACATAATTACTGTGCGCTGGCCGAGATGGAAGAATCAAATGGTATTTCAGTAATCTTAGCTTCATTGATTTGAGAAACTTCATTGTCAGCCTGAGAATTTTCAATTGTAGTACTCATTACAGAAGAAGGCGCATCTTCAACAGCTGTAGATGTTGTAGACGTTGCATTATTGACCTTCTGTACATAATTACTGGGAAATATCCCCACATTATCTTTCAATCGTCCTGTCCACCATTCTCCCTCCTGTTTTATCACAGCTATCACATCACCTGTATTGAAGGTTAGATCACCGGGTTCTTGAGACTGGTAAGGGTAATTAGCCACATAATAATCTCTTATAGTTTCAACCTCCACGGTTGGAGAAATAACATCTGTGCTGGTTGGTTCGATGGTCGCTTCATTGGGCTCGGATATTTCTGCTATACCTTCGAGTGGCTTGCTTTCTTGCATCTGAAAAAGTCGAGTGGCTTGCTTTCTTGCATTCCAGATATTTCTGCTATACCTTCAAGTGGCTTGCTTTCTTGCATTCCGGTGAAAAGCGGAGGTTCTTGACTCACTCCCGCAGAAATACCTCCTCCCTCTATAGGTTCAACATAAGACTCAGGAAACCACCCAGTTTGTCCTCTAATCTCCCCTGCTAACCAGCCGGGTTCTGCATTTTGTATCTTTGGTACGTTGATAATGTCGCCTGGTTGGAATGATATTTCATCTTGATTTCTGGCAACAAACTCATACAAGGCCCTATATTTCACAAAATCAACACTCGTAATCTGTTCTGTTTCTGGGACAGAATCTGTTGATTGCCAATTATCAGTTGGCCAATCACTGACCTGAGCATCATCGTTCCATGCAGAATCATTTTTCCATGAAGAATTATAATCGACAGATTTTGTCGCCTGTTTCATCTGCTGCACAATATCCCTCTTCCAAACTTATGCGCCGATCTCTTCGGCGCATAAGTTTGGAAGAG
>TRINITY_DN119_c0_g1
GTTTCTTTGAAAAAGTAATAATTATTAAACTCAAATTTCGTATACCGCTTCGGATTTCGAAACATTCTTTGTAAAAAGGATGTCTAATCCAGAAGAGAGATCGTCACAAAAGAACACGGAAGAATCCACCAAAGACGATGAGTCATTCAAAAAACCAGCAAATCGTAAACGTAAAAAAAAACACTAAAGAAAGATGATAACAAAACTCCTGAGGCAGAAATCAGCCAGCCACATCTGGT
>TRINITY_DN99_c0_g1
CACCAATGTAAAAAAGGCTTAAATGGTCTAGTTTTTAACTCACACTTACATAAAAATATTCGGCTGGACCATTTTATGTGTGCCGTTTGGTATGCAAAAATATAATACTTACCAGATATAACCATATCCAAATAAGCCATCTTTATTAATTACAGGTTACATCTATTTTTCCGATTATTTTCAATTGAGTTTGTTCCTCTTCTTCAAACCCAAATGGTAACCATTTATGGGAGTTAGTCCTAAAGCTTGTTTGTTCAATTTGAGACACACTTCTGTTCTCTGAATTGGAACTATTTCGAAGTTACACAACATCTTGAATAATATTATTTTCATTTCCATTAAGGCGAATCTGTTTCCCAGGCAAAGTCTCGGCCCTACTCCAAAAGGTAAATAGGCATAGGGGTTGATTGTTTTTTTATTTTCAGCAGAGAATCGTTCCGGATCGAATTTTTCAGGGTGTTCATAATTTTTAGGATCATAGTGTAATCCTATTATTGGTATTAATATCAACGAACCTGGTTCCAAGGTTAACGGTTGCTCATCTGGTTCCTCTGGTTGTATTGTATATTTTTTTGTACTAACTCTGTCTATTATTGTGAGAAAAGGCCACATCCTCAGTCCTTCTGTAAACATAATTATAATTTAGAATTTTTATTATCAGGTTTTGAGGATTAATCATTGCATGAATTGTGCATTATTCCCATTTTACGCTCTTTTTCCGGATACGCATATGATGTAATTTCCAGTCTGCTTTTGACATTCGACGCCATTGCTAAAAATAGAAAAATATTAGCTGTTGGAACAAGTTAGTCATGTGAAGACTTGAAACCGTGTACGTCGTACAACTGACAATATTGCTGCTGTAGCCCGTAGTGTTGTTGAAAACCCTGGTTTGTTGATTTTAGTAATTAGCCATTCAGATATAACCATATCCAAATAGATATAACCATATCCAAATAACTCATATTCAGGAGTTTTCCATAAGATGGCATTTCATTATCTGCGAAATTTTCATCAATCTCATCAATCAATCTTTTTTGTATATCTGGATTCAATGCTAGCTGATGAGCGATAGGTCATTTTTGATTTCCGGCGATAGGTCATTTTTGATTTCCTTACAAAACACAACACATTTGAGATTGCTTCGAAACCGGCATTAAATGCGAAGAATGTTAATGCTGCCATGTCTGTTACCGATAGGTCATTTTTGATTTCCTCAGTTCTCCAATTTTTTTCTTTCACAACGGATCCGTCTTTTGTTGTTATTGCTTTTACTTCGTTCGCTTCAGAAGATTGTATGAGCTTTCCCACTAAATCTGGTTGAGTTATGTTTTGTGCTTTCCTGATTGCTATCGTGTCTTTAATGAGTTTGACAAAGAAAGACTGAACTTCTTTTTCGGCCAATGGCAGACGGAAAAACGCGGAAATTCTTGGAGCTAATTGATAGAAAAGTATTGAATATTTTTTTCGATATCCACAAATATGTGTACCCTTCTTTGCCATCTCATAGAAAATGTTATTCCTGTCTTTCAAAGAATCTATTTCTACGCCATATATGTTTCTCGCTATCACATCATTTGAAAATCGGCTCAAAAGATCTTTCAACTCAACTTCTAAGATTGTTTGATCATTTTTCATGATACAATCCACCAACTTATCGGCATTATATTTTTCTTGATATAATCCACCAACTTATCGGCATTATGCGATATCTGATTGAAAAACACTTTCATCTTGCTACTGGTGTAAACAGGGCTCATAGTTGATCGGACATTCTTCCATTCTTCTCCTTTAATCGAGACTGAATTTCTCGTGAACATTAGAAAACAAATTGTTATCGAGACTGAATTTCTCGTGAACAAATCATCAGCATGATCTGGTACTAAAGTCATCCGATTCACGAAATGGTCGAAATTTTTCACACACAGCTCCTTAACGAGATCCGGAGATTTCACAACTAGCAAGGGAGTGGTGAAAAAATAAACTCCGAAATACCTTTCATTAGAAAACAAATTGTATATACGATGTACTTGCTCGGTCAAACTTTCTAAGCTTAGTAGAACCCAAAAGTTCTCTCCGAAAAAAGGTATCCCTTTTGATGCTTTCACATTTTTATATTTCCAGAAGTTGAACGGTTTTATGGCGAAAAAGTACGTCAATAATGCCAACAGTATGAGAAGTAGAATTGCCAACATCTCAACAATTATTTTGGATTATCGAGAACTATAACCCTTAAAAAACTAATGATATCAGAAAACTTCCACTCGTTTCACTTGTATAATGATTTTTTCATATCATATATTTGATATATGTCATTATTGTGTTACATGATAGATTAATTGATTATTCCCATTTAGTTGTTTGCCATTACTGATCCTTCATTACAGAAATTATTGTTTTTAAGATATCAGTGACATTGTAGCCGACCCTTAATGACTTTAACTCATTTAAATTAAGACCTAGCAGCTGAGGCAGCAGCAGCCTTCTCTTCTTCCCTAATCCTATCCTTCTTGAGAGGACCCATGAATGCAGCCTTATCAGCAGCAGTCTGGAACCTACCATGACCGAATTTGGAAGATGTATCAATGAACTTCAAGTTGATCTTTTCCAAAGCAACACGTTTGGTGTGCACCAACAAGGACTTTCTCAAAGTGATGACCCTCTTCTTGGTTCCCATGCAACATCCCTTGATCATGACGAAGTCGTTATTAACTTCACCATAATGGGGGAAACCACCCATGGGTGTGATAGTTTTTTCAGTCAAATCGTACTGGGTGGAAGCGTTGTTTTTAATAACCTTTCCATCCTTGGTGTGGATTCCAGCACCGATTCTGTAGATCTTCTTGTTGATTTCAGTACGATGATGGTATCCCTTTTGACCAGCACGGGCAACTGTGAAGGACACCCTGGAAGGATGCCATGCTCCAATACAGGCAACTTTACGGAGACCCTTGTGCGTCTTACGGGGCAATTTTTTGGTGTGCCACCTTGAGGTTACACCTTTGAATCCTTTGCCCTTGGTAACACCAATGCAATCGATCATCTCATCCTGAGCGAACACTTCAGAAATTGGGACTGGCTTTTCAAAGTGTTTCCTGGCCCATTCAACCTTATCGGCGATGGATCCACCGTTCAACTGAATTTCCATAATGTCGGCTTTCTTCTGCCTTTGTTTCAAAAGTTTCATCTGGGTATGGGCGATGACCCTGACAACTTTGCAGTACTTGATGATTTTTTTCAAATCTCTTTCGATAGATTTCTTTCCTAAATCATCGGACCACTTTTTGGAGGCCTTGGTGAATGCCTTCTTCTTACTTTTATACCAATTCTTATAAAATCGCCTACGGCAATCCTCAGACAAATGCTCAGCCCATACAGTTGCAAGAGCTCTAAGACCGTGAGGAGTTTCAATATATCCTACAACTCCTACGATCATCATTGGTGCGGTTTCCAAGATTGTGACTGCTTCCACAATTTCTTTCTTGTTAATTTTTGATCCTGGACGATCAGCTTCCCTCACTACATGGGTCATACCAGATTTGTAACCCATGAATGCGGTCAAATGAACGGGTTTGGAGGGATCATCCTTGGGGAAGGCCTTGACCTTACCACGATGTCTCCTGGACCTTTTTTTGGGGTAGAATCCCATGGACCCATGACGGGGTGCACTAAACTTACGGTGAGACATTGCGCGAATCACCAATCTGAAAG
>TRINITY_DN39_c0_g1
GGAGACTTGTTATGTTCAATAACTGGGTTTGATTCATTCTCATTGCAACCAAATGCTGGCGCGGCTGGAGAATATGCTGGCCTCATGGTTATCCGTGCGGCTGGAGAGTATGCTGGCCTCATGGTTATCCGTGCTTACCATATGGCAAGGGGAGACCACCACCGGAACGTGTGCATCATTCCACTCTCAGCACACGGGACGAACCCTGCAAGTGCAGCCATGTGTGGAATGAAGATTGTATCTGTCGGAACCGATTCAAAAGGAAACATCAACATTCCAGAGTTGAAGAAGGCTGCAGAGGCCAACAAGGAGATGCCATGTGTGGAATGAAGATCGTGTCTGTTGGAACCGATTCAAAGGGAAACATCAACATTGCAGAGCTGAAGAAGGCTGCAGAAGCCAACAAGGAGAATCTCTCAGCACTCATGGTTACATATCCTTCCACTCATGGAGTGTATGAAGAAGGCATTGAT
>TRINITY_DN39_c0_g2
TTGATGAGATTTGTAAGATCATTCATGAGAATGGAGGTCAAGTCTATATGGATGGAGCCAACATGAATGCTCAGGTGGGTCTAACAAGCCCTGGTTGGATTGGAGCTGATGTTTGCCATCTCAATCTCCACAAAACATTTTGCATTCCACATGGAGGAGGTGGCCCTGGCATGGGCCCTATTGGTGTCAAGAAGCACTTAGCACCATTTTTGCCTTCACATCCTGTGGTACCTACTGGAGGCATTCCTGCTCCTGACAAAGCACAGCCTCTTGGTACCATTGCTGCTGCACCATGGGGGTCTGCTCTGATTCTCCCGATATCTTACACTTATATAGCCATGATGGGTTCTGAGGGTCTAACCAATGCGTCTAAGATTGCTATTCTGAACGCAAACTACATGGCCAAACGTTTAGAGAATCATTACCCTGTTCTCTTCCGTGGAGTCAATGGAACAGTTGCCCACGAATTCATCATTGACTTGAGAGGGTTCAAGCAAACTGCTGGAATAGAGCCTGAAGATGTTGCTAAACGTCTAATGGATTATGGTTTCCATGCACCTACCATGTCATGGCCTGTCCCAGGCACACTCATGATCGAACCCACAGAGAGTGAAAGCAAGGCGGAGTTGGATAGATTCTGTGATGCCCTTATTTCGATCAGAGAAGAAATCGCCCAGATTGAGAAAGGAAAAGCTGATATCAACAACAATGTCCTAAAGGGTGCACCTCATCCACCATCTTTGCTAATGGGAGATGCATGGACAAAGCCATACTCTAGGGAATATGCAGCTTTTCCAGCTTCCTGGCTCAGGGCTTCCAAGTTCTGGCCATCAACAGGACGTGTTGACAATGTGTATGGTGATCGCAACCTGATTTGCACCCTACAGCCAACGAACCAGGTTGTCGAGGAAGCAGCAGCAGCCAGTGCTTAGTTTCCTATTCACTTCACCTTCCTGCAAAACTCTCAATGATATTATATCCTCTCTCTGTTTCACCCCTCTAGTTTCACTGTACATACGTTACCAATATTCATATTTGTCATTTTCACTTTCCTGATATGTTGAAAATTACAAGTTGCTGCAATATAACACTTGTTGCTGATTGCAACGTCATTGTAGTAATTGTTGCCTTGGCA
>TRINITY_DN44_c0_g1
AACATATCATATAATACCTGAAATGTATTATTTTTATTTATAGATTTATATAACGATGCATTGCCAATTCTAGCTACGTCACTGTTTTGGTTAGATGTAATCGTTTTCAATTTTAAAGAGAACTCGTTTGAACATATCATTTGAAAATATTTTAGGTAGAAACTGTTTTTTAGGTTGGCAAGATTGCAAATAAATCTTCAAACTATTGTTTGATACGATCAAATCAATATCTCTTGCCAGCATAAGTGTTTCATTCAACAATATCAACGTCTGTTGTATTGAAATTTTTACAATTTTGATTCATAGGTAAGAATATTTCTAGTGGGTCATCTACTCCTACCTTAAAAGGATGCTCTTACTAGATAGAACAAGCATTTTCGAATTATTTTAGAAGACTACTAATCTTTCCCTAATTCGTATAATTGTTTTTTTCTTTGTGTTCACAATAGCCCAAGAAGATTAACAATAATTCTGCATGATTTAAGTGTGTCCACATGAGAAAGGAATATTCAATAGTATAGTAATATTTATTCTTCATATTATATGTAGTGTTATTATTGTTCGATACTATGTAGCAATGTCTTAATTCTG
>TRINITY_DN60_c0_g1
AAATAATTTTCTTCTCAAAGAGAATAAAAAATGAAATAATCAATTTTCTTCAAATTAAAAATTCCCAAAAAATAACTTAGGACTTTTTATTATGCTTGCTCCAGAAATTTATTCAACAGTGTTTATTCAAATTGGCGTGGTTTTCTATATTTAAATTTCCTAAATGTATGTAAAATCCAATAAATTCATTTCAATTTGACATATTGAGAATAATTCAACCTCATTGTCCACTGGTTGCATTGAAATATTTAAGAATTTTTGTTGTTTCTATTAACCTCTGAATGATTTAACTGATGTTTCATTTCATTTAAAACTAATCAGATTTGCATATAAATACTCCATCATAGAAGAAGAAAGTTTTTTTGAAGGGAGAACAATAAAAAATTGCAATTCATCAATTTGAATTAACAGACGTATTTAAGTCGGAAAATGTTAACGTTTTCTCTCTTTAGATTGATATAAGGTGCAATTAATCATGCATTATCATGAAATGAATAATTGGTAACCATGGTAGCAAGGATGGCCAGCAAGGTTTGACAACGAAATAAAAAAGGAATATGAAGCACCAGAGCCATGTTTTCCAACTTTAAGGGTATGATGCACTATTCGAACATACATGTACATGTGCTATAAATGCTTGCTGGAGAAGATAATAGCAAATGTGAGAATAAATTTTCACATTTGTTTCAAATGTTCCCAAGTTTTGGCGATTACAGAGACGTTCAATTAGGAAAAGATAAATAAAATGTAGAATATTTGATCATTTTCTAATTAAAAATTCAAGACTCTTACAGAAGATCTGCATTATAACACCTTGATAATAACATTTTGTGATTTGTTCAATGAGGATATTATCAAACCTCATCTAACCACTGAAAATCTGAAAAATTCGTCAAGCTAAATTGTGGTTGATTGAATTTAAATATGTAGTGCATCTTTTTATACGACTAAAGTAAATAACCTTTCGTGGTATTTACTAGTCTTTAAGAATAGATAATATAGCACAATACACATTAACAATATTTCATGTTACTCCTCCAAAATATAATTGTTCATTTCCACCGCAACTAAAAGATCGAAAATTAATTTGAAAAAAAAAAATAAAAAATTCAAGTGAAGATAATTTTCTCAGCATGAATGAATGAAGCGAGATTCACTCAAATTACCTTTCTGAACGAAATATAAATATGTATATAAATTGGCCACGAAAAATTATTTGCAACATAGTTTTTTAGTCAATATTTGATGCAGATTGTATACAACATACCCTAAATTGACCATATTCACCGTCGCCATATTGTTGTGCGACAATACCAACCACCCAGTGTTCCCAACGGAGAAATATTGAGTTCACTAGAAAAATACCACTAATATCAAAAATACTATCGGCCATAGAGATTATTCTTCCTCTGACTATTTCCAAAAATGGAGCGAAGCCTTCATTTATACACTCGGCCACAGTTAATTTGTTCATAAAACCACCTTTCACTAATGTTATTATTTCCAAAAGGTG
>TRINITY_DN156_c0_g1
TGGTCATAATCATTCTTGGATCGATTGCTAATCGAGTAATTTACAGAGGGCCACATCACACACAAGCCATATTGTTGGGTACAACAAGCATATGACACCTACTGATTAGCCATCACACAAGGGGCCATATTGTTGGGTCGCTAGCTATATTGTTGTCTCCATGGTATATACAGAAGTTCACACAAATGAGGTCTGCAAACCTCCGGGGCCTTTGGTATTCAATTTTACCTGTATATAGCCGGGGATCAAGCACTGTGTCCTCCTTCAGTCATTGGGCTCCATCTCGCCGAGTTGTAACGGGCGCAAGCGTTGATACTTGCTTCGATCATTTAGGCCTCAGAGACACCGTTGTTGCATATGTTTGCAAATGCTCTCATGTATTTCATGCCATACTGAGTG
>TRINITY_DN139_c0_g1
CATAGTTCCACACCGTACACTGTAAATCGCCAGTCTTAAACGAAGATATTTTAGCTGGCATCATACCAATATACCATTCACCATAGATGCCAAAAGGACAGACAAGTTGCCCTCCTGTATCTAGAAAGAAGGAATCTAGCAAAGTAGTAGCAATTTTTTGTCACTTCTATGTGCTGAAATGAACCTTTTGATATCACTTCTTATGGGTGAAGGATAGATGATTGCGTTGCTCATTTTTAAATATATG
>TRINITY_DN133_c0_g1
ATGAAACTGGTGTTGCTCCGGATTGGAATGACGTAAATTTCACCAACGAATTCTTAGGCGAATTAGAGAGAATACTCAAACAACTGATGAGCGACATTGAAACGAACGTGCTGTCATCTCCGAGGGAAGACAAGGGGAAAGAAGGAACAAGCGATGAGAGCAATGACATGACATGGAAGTGTAGTTTAATGGATAATGATTTACGCAAGATGGTTGCCTGTGCGCATCAGTCATTGATTGTTCAAAGCAGAGCGACAGCAAATGGGTGAGGAATGAATACATCAGTTCATCTTACTTTCTTCCGGCCGGTGCTTGGGCCAGACCTTGTTGAGACCTAGCTGTAGCTTCTATGCTTTTCTTGACTTTTATCTCGCCTGCGAGTCTAGAAGCTTCTAATTTTAAGGTGCGAAGCTGATTCTTCAACGCACCTAAGTCTCTGTCTCGAGCTTCCCTAAGTCTTTTAGCTTGCAACCATTTTTCCTCATTTTCTCTTTTCTTTTTGTTTAGTTCCAATTTTGCTTCACGCTCCCG
>TRINITY_DN114_c4_g2
GTCGAATATCCTCAAAATTAGAGACTCCTTCTTCTCTCCTATGTTTTCAGGAACGAATGTGACCGTCACCTCCAGTGAAGAACAAGGATCCAGATATCCATTGAATGTTGATATTTTGAACTCCGATGTGACATCTATTTCAAACTCGAAATAAATCATGACAGCTGTGTAATTCCTCAGTATAAACTTCTCAGATTCCGTTTTACCCAAGATGACTTTGTGGAAATTGACGAATTTCGGTGTAACCTCAAACTTTAATGGACAAGCAAAACAGGAAAGATTTACTTCTTGTACTCTCGGATTGTCCCTTATAATGATCAGTAGCGTTTCTCTGAAAAGGCCCTCCGCTGGCGGTTTGGCGTAAATGGGCAGAACGTGCTGTCTTCCTGCTTTGATTTCAACAATCTTCTGCTCCTCGTCAATGAAGAACACATTTTCATCACTTTTGAATGCGATGCTGATATAACACATCATACCCGAAGTGTTCAGCATAGAAATCGAGCTCTTCA
>TRINITY_DN49_c0_g1
TCACCATATTATAATCAACAACTCTTTCCATTATTTTGAAGCTTCATTGAAAATACCTACCTAGGTATATTTTCATGTTGAAAATATGAATTGATATTTTCTGTATTGAAGAATGAGGAAATAGAGTTTTTTCATGAATATCTAAAGATATCGAATCGATCAATATGATAATATTTTTTAATTCGATTTCATGGATTCGAATCTTCATATTATCCTAACTATTTACGAATTTTTAGAGCTGTATTTTAATTCAATTCAGATGAGTTGTTATTAAAGGGTTATTAATTTAAGATATTCGTTTGTAATTTAAGATATTCGTTTGTGTTTGCGAAGAGGATAATTTTAAGTGAACTCCAAAAAACTAATCTTCATGTGACGTATTTTTCTCAGAAGGAAATTCTGTCTTCTCAGACGAAAAAGGACAATTTTAGCAGCAGGTGTTCAATCCAGACCATAATCTTCATGTGACGTATTTTCCTCAGAATGAAATTCTGTCTTCTTAGACGAAAAACGACAATTTCAGCAGCAGGTGTTCAATCCAGACAATAATAGTCGTAAACTGAGATCTTCCGGTTCAACAGATGGGACCAAGAGACATACATTGATTTTCCTTAAATTGTTCGAATTTTCATCTTAAAATAATGAAGTCTTGCAACTATGTGATCCTCTTCAATAGGAATAGAATGTAAAGTAGATTTAACAAAACTATCTTCGTGGTAATTG
>TRINITY_DN100_c0_g2
AAAAGATAAATTTAGCGGATTATAAGTTGCCGGTTGCGAGATGGCGGATGCGCCGGGTATTCGATTTGGCCGACTTTGATGCGTTTCCTTTATGGCTTTGTCTGCTGGGAAGTCAGGCATGATTGGTATTATTTCGTCGATTGTCTTGGCTTCCGGTAGTGATTGTTACTCAGCAGAATAATCATATTTTTTGATGTTTTTTCTGGAATTGAAAATATAACATTTGTTTATGACAATGATAATTTTGGGCTAGGAGAATTATTCAAATTTTGACGGAATCGACAGTACACAGCGCATGAGC
>TRINITY_DN77_c0_g1
ATCGGTCGAAAAACGACACGTCAAAATATCAAAACAAGTCAAGTTCTCTTAGAAATGTTGATAAAACTGAATGGAAAACCATAACTTTTTAATCTGATTTGATTAAAAACAATGGCAAATCTTCAAGAAGTTCCTACGGAGGAACTGCTTTCATTTCAGGACTACCCTGTCGTACATCAAAACGCTACTGTTGAAAATAATTCGGATCAAGCACAAATTAATGTTACAATCAGTAATGATGATTTTCGAATAAATAACGTCGAAGATCCTTTAGAAAGAGAATCGGAAGCTTCTCAAAATAAATTATACTCAATATGGTCGATTGAATATTATCAGAAGTTTTTCAACGTTGACACCAAAGATGTTACAGACAGATTGATAGCTTCAATTACGCCTCTACCAAATTATTCGTTAAGACATCATATGTTGGAAAAACCGGACTTATATGGACCTTTTTGGATATCTATGACGTTAATTTTTACCATAGCAATTAGTGGAAATATATCAAATTATCTACAGCATGATGAGAACCGTCATTGGAGATATGATTTTAAACTAGTTTCTTACGCCGCAACTGTAATATGGATATATGTGATGCTAATCCCAATATCTTTGTGGGCTTTTCTTAAATGGACAGTTGAAAGTCCTTTTAATGATGAGGTATCATCCAAAACTCCCAGTTTATTACAACTTATTTGTATTTACGGGTATTCTTTGTTTATATACATTCCAGTATCAATACTATGGTCTATACAAATATTGTACCTTCAATGGTTACTAGGTCTATCCTCAGCGGCTTTGTCTGGATCTGTATTAATGTTAACATTATTGCCATCTCTTAGGGCGTCTAAACATAATTTATTTCTAATACTTAGTGTGATATCTTGCCACTTATTATTAGCTACCGGGTTAATGTTGTACTTTTTCCAAGCACATGAAAATAAAGTAGTTCAACAAAATATAACCCAAAATGTAACTGCAGTTGTTTCTGAAGTTGTAACTGAAATTATCAAGAAAACACAAACAGTAAAAGGAAACCGATAATAAAAAATATATTTATAATAGAATAAAAGTGTTATATGTAAAAACTTAAGGTATTTGAAATATATATGTCCTAACTACGAATGGGATTTTATTCTATAATTTCATTCTGAACTATTTTTGTGGAGAAGATAGATCCAATTTTTTTTCATGAAAAAATCAGGACATGGAGTTCCATTTTTAACGAAACAATAAAATTTAGCTTATATGTATATTTGTAGACAAATATTTATCCAATTCTTCGAATCACAGCGGGATACAAATTATTTACATGTTTTTTATACAATTTAAAATATGAAAGAATTAGAAATTTGTTGAATTTAAAATAGAATTGAGAAAACAAGTGAATATTAAGATTAAAATAAAAAATATCTATGCAATGTTAACACAATTCAACAACAAGGTCTTCTTTATGTTCTACTTTGATTACTTTAACTGCTTCCCCTCCGTTATTCATTATTGTGTTAATCATTTGAACATCATCACGGGAAAGTGGATCAACGGACATCATTTTATCTGTTAGAGGAATATCTTGCAATAAACACTTTCTCTTAGTCATCAGCTTAGATTTGTTACAATGTTGCACCTTAACATCATAGTGCCTCATCCTCTCCAGGTATTCATTTTGTTGAAGATTATGGGAATCTAAGGCACCTACATCGATAACATTTACTGCAAATTCTTGCAGTATCTTATTCAATGCAGATTGTTCATCAGTCTTTTTCTGAAGATTATTAGAGTTTCTTGAAAGAATATCCTCGCTGTTTGCCCTTTGCACGTTACAATTACTTGATACGGGGTCAATTAATAAATGTGTACGTTCGTTTATGTCGCCTCCGTGAGATGATCGGTCATCGTTGCATTATCATTATATTCAGTAATGTTTGATCAACGTTTTACAAGAAATTTTTCTTGGATATATATTGCTAAAAAATTTCATTACCCAAACAATTGAAAATAATAGAATAGATGAAAACACAATACACCGCTTACGATGATAAGATACTAACGTGAGATGATCGGTCATCGTTGCAAAAATAACTGTAGCAACAACCCATATTTACTCCTTTTTTTATTAGGTCTTTACATCGAAAACTGAAATGTTTTTTTAAAAATGATAGAGAGAAACATAAATAAACGATTCAGTTTGACTAGAATGAGTAGATGAATTGGTCAGCGCCATTCGTTTATCATTTAATCGGAACTAATTCCTCCTCTTTACCACTATCAAAATTTACAAGAGCATATCGCGGGGTGTCAGTTTAATTATTTTGATTTTATATTTACCATTATCATTATATTCAGTAATATTTGATCAACGTTTTATAAGAAATTGTTCTTGGATATATATTGCTGAAAAATTTCATTACCCATTCATTACCCAAAC
>TRINITY_DN121_c0_g1
TCCATGCAAAAATTCAGAGTACATACAGACCTACAAACATTTTAAAAATGTATTTTTATGTTCGATTTCTCTTTTCCCATCGCCATCCTATCCTGTAGGATGTAAATTAGTTTTTTCTACTTTATTATGTTTTGAGGTTATGCAAAGATAAACATAATATGAAGATCAACAAATCTCTTCTACCTTTTTGCTATGCAAATTATTTCCAAG
>TRINITY_DN152_c0_g1
AACATACCCTTGGAATACGAGCTGGCACGCCTAAATGAAATGGGAGTATTCAAGGCAAGTACGGGAAATATATTAAGAGGTCAAAGGAGGGGCAATGGGATCAGAGAAGAATTCCAAACTGAAGATTTAAAAATGTGAGTCCGAGCGAGAAGAAGATATAAACGAATGTAAGAAGGTGGTAGGAAATGGAAGACAAGCATATAAGCTACCTCCAGGAACACCACCAATAGATGGAAAGATAGTTGGAGCTGTATATCGCAGGAATAGGAAGAAAGGGG
>TRINITY_DN148_c0_g1
GGAAAATTGTTGAACAGTTTGTTGTAATATATATCATACCTAATCACAAAAAAATCTGGACCCTTACAACCGCGGCATGGATTTTGGCTTCACAGCAGAAGACGTTATCCAAGACGGAAGATGCGAAAGAAAAAATATAGAAGAGATAAAAGTTTGGATGAAAAAATTCGCACTTCCACAAGCAACGGATGAACATATTGTTCTGTTTCTTTTATCTTGTAGGGGTGATATTGAATATACCAAAAGGACAATTCAGTCTTATTTCTATTATACGCACCATGGAAAGAACATCACGAATAATAGAAATATTCACTCCAAAGAGCTGATGAAACAAGCAACAATTGTCGAAAGTGTTGTGATTCCTAAAAGGACCAAGGACAATTACCAGGTGATATTACAGAGGTTAAAGGACTTCTCACATTGGAATTTCAACTTGGAAACGTCCATCAAGTTTCTCTTCATGACTTTGGACATGGGTTTGATCGATAAACAACCCCCTGATGGAATAGTGGCAATTTTCGACATGACAGGTATCAGCATCTTACATCTCACAAAACTTAGAGTCAACCCACTGAAAATATTTTTCCACTTGCTTCAAGAAGCCATGCCGTGCCAAACCAAAGCCATACACATCTTGAATTCTGCCTATTTCATTGACAAACTTATAGCCATAATAAAACCGCTGATGAAAAAAGAACTTTATGATAAGCTGTATTTTCACCAGCCTAACATGGATATGAAGGAATTCTTCGAAAATTACGTGGAGGCAGAATGTATGCCATCAGATTTCGGTGGGAAATTACCTTCTGTTAGGGACCTCAGCGACACCACGTTGGAAAACATGAAAAAGAAATCAGAGTGGTTTGCTGCAGAGGAGACGATTAGGAAAAATTACAAGCCCCCTTCTTAGTGTTGCTGTGTTCGTATTTCACGTTTGTGGATTTAGTATTGTTTTGAAATCAAGTCATTGCTCG
>TRINITY_DN82_c0_g1
GTTTTATTTGAAAAAATTTTCAGATATAAAATTTATTAAGTATAAAATAAAACATACATCAGCAACGAAGGTCCAAGATTATTCAAACAGTCGAAACAGATTTATCATTCATATCTTGCAAATTCTGGATTCTTTGTTGTAATCCCATAATCGTTCTTATCTGTTTTGCCGCTTCTTCAATGTCCGTTCTTGGGGATTGGTCTTTTTCACACTGGATCTCCAATTCTTTCAATTGATTGACCAACTCGCCGATAAGATTAGGAATATTTATCTCTTTCGGAGTGTTTGTTCCCCTTTGAATGAATCTGTCTAGTTCTCGGTTCAAAAGATCCGTCCTCGAATCCATCGTCATGTATTCTTCTTGAACGTCGTATGGCGGTTTTGGCAAGTCTTGAGGACTGACATATCGTGGACTCTCCTGTTTCTTCTCCTCTCGCCATTTTTTTAGGCACATCAAATTTTTTTCCTGTTGCAGTATCTTTTCTTGCTCGTTCAGTATCAACTGAAGTTTCTCCATCCAATGTTGTTTCAGTTGCGCGTCAGAAATGCTGTGAGGAATATTTTCTTTTTTCTCCTTAATATGTCCCTTCTTGTAGTAAGACTTCAGGCTTATCTGCGAGGGTCCTTTGGTAATCTCATGAACTATTTGCTTATCGTCTGGCAGTTCTTGTGAGGCTTGAATCGTCGTGGCTATCTCTACGTCTGACATGGCACTATGCAATAGGTACCAGGAGGTAGTTTGAACCTGCAGCTCACTTCGCGCAGATTGATGAAGGACGGAGATCTCGCAACTGAAGCGTTGTGGCTATCTCTACGTCTGACATACTGGACGACTCATCCACTGGCCTAGACAGACTTGTGATTGTTATAATCGGCGCCCTTTCAGGAAATCTACGTTTCGTCTTGACCTTCTTCGATTTCGTCGTGGTCAACGCCTTAGAATACCTCTCCTCAATATCACCAGTTTCGTTGCTCGCTATTGTTATAATCGGCGCTCTTTCAGGGAATCTACGTTTTGTCTTCAACTTCTTCGATTTCGTCGTGGTTAACGCCTTAGAATACCTCTCCTCTATATCACCAGTTTCGTTGCTCGCGTCGGTATATAGAGACGTTTCTGAAGACCTCCTGGTGTTCAAACAATCAGTATAAAGAGACGTTTCTGATGACCTCCTGGTGTTCAAACAATCGGCATCAGGTCTGGAAATCGTGTCGGCCTCTCCTTCCTTGTCAGGTCTGGAGATCGTGTCGGCCTCTCCTTCCTTCGAATTCTCGAGCAGATAGCGCTCTTTCAGATATGCGCAGATAGCTTCTGATCCCTCATTTATTACGGACCTACTTGGATATATCAGAGGATTCATGGAGACGTGTAAAACTCTCAATTTCGGAACCAAACCCAATTCATTTGGAAGTTTCTCCAAGTAGTTGTTGGAAACCAGTAAATTTTCTAGATTTTCATGATTTGCAATGCTTTTCGGAATGCACCTCAGTCTGTTCTTTCTCAGATCGAGCCAATTCAATTGTTTTTTCTCAGATCGAGCCAATTCAATTTACTCAAAATGGTGAAAAAATCGTCGGGCAGGTATTCAATGGAATTGTCTTGCAGATAGAGCATCTTAAGATCGGGCAGGTATTCAATGGAATTATCTTGCAGATAGAGCATCTTAAGATTGAACATGCGGAGAACATCTTCTGGAATTTTGGTCAGTTCCTCTTCGGAATGGTCTGCAATGATATCGTATTCAGTCATGATGTTTCACTGGGAGCATCGATGTTCTCGATTCGCTAGAAAAATTGTATGAGTAATTTTGATTACGATTTGATGTTTCGTTTCCTTCATGTCATGCTTCTGTCTATATGGAGGTAAAAG
>TRINITY_DN54_c0_g1
CAGCGACTTACGTTCGGAATGACGTGTGACAACTGAAAATATGAGGAAAAGGAATTTCCTTAGGATATGCATATTGGTTTTCCTCATTTTCGCGAGTTTTATGGATTTAGGTATTTTAGTGATAATTGGTTGTTACCAGCCGCAATTTTTCTGGATGTACCTTCTCATGTTCGGAGTATTCTACACACTAGGAGGTATTGGTACCTATAAGGAGAGATACTTGTTGCTTTATATATTTGCTGCCTATATAGTATTGAGCAGATTTGTTGATATTGCAATGAGAACGATGGATATAGTAAAGTCAGATCACTCATCTGAATCTGCGCTGACAGGTACTAGGGCAAAACGAGACGTCCTTATAAAAAAAGATGGCAACTGTTGCGTGGTCAATTTTGATTTCACTGAAGAATATATCATCCCCAGTTGTTGTCATGATGATCCCACACGTGGTGATCCTTTTTCCGAAGCTTGTAGGATGGCAGGATACGGTACATATGCATATAAATGTGAAGACAAAAGCGGAAGAAAAGCATCATCTTCACCAGGCAAAGAGGATCAGAAAAAGTCGAAACCCATTTCGTTTTTCGCTATATTTTACTGTGTAAGATCTATTATCGATGTGATTATTTTATTTTTTGTTTTTCTACTGGCCTATATGTTGCAATATAAAAAATGATCTCAGTCTTGACGTAAAATATCTTTTTCTCCGAAAGGTCGAACAAAAAAGTAATAAATAATTTCCACAAAACTCAAGATGCTCGCCCCCAAGAAGAGTGCAGTAATGCCACCTGTTGAAACTACAAAATCCAATTTTCCCCTTACAACATTCCTTTTACACCTCTCACTAGGCAATCGTAGAAGGCTTATTTCTACAACACCAAACTCCTCTTTGATACTATATATTAACAAAAAATCAACATAATTTCGAATATAACTCGGAGTTTATATCATCTTCATTACCCAAATTTGACATCCTTGACGACCAAATTTGACATCCTTGACGACTGACATTTCGAACTCGGTACAACTTGGCAAGCAATCACATACTAAGCCGGTTCTATTAGACCAATGAGCCTTCAGAACTATCAGGTCG
>TRINITY_DN51_c0_g1
CTTAATCCCGTCACCAAACCTATTTCATTATGCTTTTTGTTATTGAAGCCAATTGTTCACTTCCTCTGCAGCCAGAATTGCTTAAAGTCAATATGAAGTTAATTATTCTGTTCTTTCAGTCAGAATTGCTTTAAGTTAAAATGAAGTTAATTATTCTGTTCTTTGTAATGGTAATTGGTTACTCTAGAGCTGCATTCACTCTAAAAGATTGTGAACCCAATGGTAATTGGTTACTCCACAGCTGCGTTCACTCTAAAAGATTGTGAACCTCCTACCTTACCCGGAAGATGCAAGGCGCATATGAGAATTTTCTACTGGAATGGTAGTGCATGTACCAAAGGAATGTACGGAGGCTGTGGAAGCAGACAGAAAATTTTTCTAACGAAAATTGATTGTCTGAGAATAGCAAAACCTATATGTTCTACGGAAACAAAAGGAGGAAATATGTTCGATAAACTCAAGAAAAAGCTTCAATAAAGGGGAAATGAAAAATATTTTTCTCAAATAAATATTTACACAATGATAAACTCAAGAAGAAGCTTCAATAAAAGGGAAAGAAAAAATATGTTTCTCAAATAAATATTTACAGA
>TRINITY_DN114_c9_g1
GAAGAAACCTGCTCAGGATATATTCCTGGATCCGAATATAGAGGATGATAAACCTACAGTGCAACGTACAACGAAAATTATCGTTTTTCACGGAAACAAATACACAGATTTCTTAAGAGCAGCTAACCACACTTCACGGATTTTGAAAATCCCAAGGTACAACTTGGATAAAATGATTGTCGATATATTGGTCGACAATAAGACTGCTTTCTCTATGGAGGTCAATCAGATTTTAGAGGATGCGTATATGTTGAGAATGGATGCAGAAGACTGCTGCTGCAGGGAAA
>TRINITY_DN161_c0_g1
GCCTGTTTGTTTACGAGGTTAAATAAAAGTTACTCAGTAAAATAGGTACCAAGAGATCTTGTTGTGTTAAAATATTACGTGACATTAATCTACGCTTCAAATGAAAAATAAGTTTATGTGCATGACACTATTTAAAATGTTACTGCAGATGCAAACCGAAATTCCTCTGGTAAAGCATATCAAAGAAGCAATCAGAATTTCAAAACTCTTCCAACAAATTTCATTATGAATTTTAGTTTCGATGATGAAACACTCCTGACAAGAATAAACCCTTCGTGAAGCCAAGATGAATCCCACAACCAAGACCGCAATCGACATCGTCGCCGCCAATGATGTTCTCTCAGCGAAAGTTATCGGCATGGTGGTCCTAGGGCTCAGTTCGTTCATACTGGGCATACTTCCTATGAAACTCTCCAA
>TRINITY_DN103_c0_g1
CCGATCGTAAAGTAGAAGTGCAAGAGATACACACATCCATTATCATCGGTGAGTGAGATTTGAGACCAAATATACTGCTGCCGTAGGTGAAAGAAGATCCAAATTTATCCATTCCTCACCGCGCACAATATTTGGGCCGCTCTTACGGCACGCTATGGCGTATTTCGCTTCCAGATTTGCATATTCACTTGGGCACAAACTTGGTGCGTACAGACCAATACGTCGGTTCCTTCGACCTAGCAGACAGTAAAATCTTTCTCCCTCGCGAATATGAAAATACAGGTTGGTCCTGATTTTAGTTCAATATCTTTGGCGTCGGATAGAACAACTCTTTTCATGAAAAAAAGTTTACGAGCTTACGGCACTCAATCCATTTTAAAGCAGGAGTTCGATAAACATCTGGACCACTTTGTAGCTGCTCATCACTTGTTCGAAATTTTGATAAGATGTTTGTCTTTTACGCTTCAGATGATATCAGCTGTATATATATCTGCTATCATTTTGAAATTTTTGGGAGAAGGAGGCACTTCATCTTCTAATGTAGGTTTGGCCATAACCCAATCGTTCGTTCTCAGCACTTTCTTGGATTGGGGAGTTCTTCAATGGGTTATGCTGGAAAGCGTCATGACAAACTTTCAACGTGCCGCAGATTACACTGATATAAAGCAAGAAATACAGACTGGCCAAAGTGTGGACGATTGGCCTTCTCAAGCATGTCTCAAATATCAGAACGTCAGCTTGATATACAAAAAAAATAACGAAACAGTTTTGAGGAACTTGAGTTTCACTATAAATCCCGATTGGCCTTCTCAAGGATGTATTAAATATCAAAACGTCAGCTTGATTGGGTCTATCAAATATCAAAACGTCAGCTTGATATACAGAAAAAATAACGAAACAGTTTTGAAGAACTTGAGTTTCACTATAAATCCAAAAGAAAAAATCGGTATAGTTGGCAGAACTGGTGCCGGCAAGTCTTCGATAATAGTAACACTATTCAGACTCTACGACGTTGAAGGTGATATTATCATAGATGACGTCAACATCAAAACTTTATCACTAAAATCTTCAATAATCGTAACACTGTTCAGACTCTACGACGTTGATGGTGATATTATCATAGATGGCATCAACATCAAAACTTTATCACTAATGTCAACATCAAAACTTTATCACTAGATCATCTTCGAAATCACATCAGTATAATACCTCAAGATCCTATTATCATTTTCAGTGGTTCGATTCGTTCTAATGTTGATCCCATAATACCTCAAGATCCTATTATTTTCAGTGGTTCAATTCGTTCTAATGTTGATCCATTAGGAAAATTCTCTGATAATGACTCGATTCGTTCTAATGTTGATCCGTTAGGAAAATTCTCTGATAATGATATTTGGCAAGCATTGAATGCTGTAAATCTCAAATCGGCCATAACTGATCTGAACCAAGATATTCACGAATCTGGTCTCACCCACAGCGTTGGTCAAAGACAGCTGCTATGTTTAGCTCGTGCTATTGTCCTGAATGCTGTAAACCTCAAATCATCCATAACCGATCTGGACCAAGATCTCAAATCTTCCATAACCGATCTGGACCAAGATATTCAAGAATCTGGTCTAAGTTACAGCGTTGGTCAGAGACAGTTGTTATGTTTAGCTCGTGCTATTGTCAGGAAAACTAAGATAATAATTCTGGATGAAGCTACAGCGAACATAGATGAAGCTACAGCGAACATGGAAAAGATAATAATCCTGGATGAAGCTACAGCGAACATGGACGAAGAAACCGATCTTTTCATTCACAAAAAAATCGAGGAATTGTTCGAGAACAAAATCGAGGAATTGTTCGAAAATTGCACAACAATCACTGTTGCCCACAGATTAAATTCTGTGATGAAATGCAATAGGGTTATTGTGATGGACAGACTAAATTCTGTGATGAAGAATTGCACAACAATCACTGTTGCTCACAGACTAAATTCTGTGATGAAATGCGATAGGGTTATTGTGATGGACAGAGGAGAGATTATCGAATTTGATAGTCCAAATACTCTCTTGGAGAATAAAGATAGTGTATTCTATAAAATGGTGCATCATCAGGAGATTATCGAATTTGATAGTCCGAATAGTCTTTTGGAGAATAAAGATAGTGTTTTCTATAAAATGGTGCATCATCATGGTAATTGAGCTACTACCTGTCAAATTTAACGAAGTAATTATACATATAATTCGTAATCTTTTGAGAAAGTAATCCCACAAGCAAGCAACAAGTCTGTTTTATTGTTCAGAGTTATAAATAACAAATAAGCGATATGCTGTCAACCCAATAAGGAGACTAATAGTTGTCCTGGATAACCTGGATGAAGAAGGGATTGAATCAATTGTTTCTCCTAACTAAATTCCATGTATTACAAAATTGGCGATATGAATCACCGATGTACCTGAAAAGACTGAACCTATTATGTAATCAGATGTAGTTATATGTCGTTTTGAAGATATTTAGATATCGTTGAAAAATGTTTTTTTTTTCTCAAATAAAAGTTTTCGATCCCAATGAGCGACTACCTGTCGAATTTTACGAAGTTATTATACATATGATATGATAATTATTATTATTGGTAATTTTATGTATATTCCTAATAAAAATTGATAATATTTCATTATTATGTATCTAAATGTTATGTGGTCCAGATTATAGTTCAATAACTTTGTCAATATATAGAAAAACTCTTTTCATGAAAAAAAGTTCATATAAACGCTTAGCTAGCCTTTCCTGAAATATATGTGGTCTGCCGTCTACTGGCTCTTATACTATTTGGAATACTGTAAGCATAAATTAATTCTAACAAATGTTTCACTTTTCTGAATAAAGATCATCAATGGTTTTTTCCCCAAAATATTCCTCAAAATCAAATAGATCATCTATTTTATTCTCAATCTCTGCTGAATTGAGACTGCCATCGTTTGAATCATTGGATCTATATGCATCCTCCAATACCTCAGTATTTACCACCAATTGCCTATTAAAATCGTTGTTAGTGATCGTAGTCATATCCATGTTGTAGATGTTTATTGTAGTTACGAATTGTGTTCGTTGTTTTGGAGTTATCCCGTTGTAAGATCTAGGATTGCTGGGTAGGCTGCCACCACTTTTGAAACGTTCCTTCTTCTTACATACATTGAAACAACCTCCAAATATTTCAAAGAAGAGACTAGCAATGCTCATGATGAAACCAATTCCGAGTAGTAAGAACATGCCTTGAGTATCATCAAGTGTCAGTGCTCGGTCCTCTACTGTTAGGGAGCTTGCTTTCCCTTTGTTTGCCGCTAAAAGAGTTCCTGTAGAAGACCTCATCACCAACCATTCAACGTCTCTCTCCATCTTTTTCAAGAATCCAGCCTGTACTACACGATCCAAACCTGCGCTGAGAACAGCTCCGTACTCAGAATTCTTGGGATAAATCATAGCGATAGAATATGTTGTTAAACATTCGTCACCGATGTGAAGAATAGCTCTTCTTTTCTTGGGCACAAACTTGGTGCGTATGATATAGTCTAAATTAGCTCTAGATCCCAAAAAAGCATAAGGCCAAAAAAGTGCTTTGGTTGTATTTTTTACACCTTCTTCTACAGTTGGAACCAAATCCACCTCACTCATGAGTTTTTCAACCATAGGATCACTGGAATTTTCGAAGCGATTGACCCATCCTGATTTATCCAATGTTCCAATTCGATAATGTCCTTGGAGAAGTTTAGATACTGTATCTACCGTTTCTGGATAAACAGGTAATGTTACGAAGGCAATGATAGATCCTGTGTAACAAGATGAAATTATTATCGTGAAAATCCAATAGAATCCTATAAAAACTCGTGTTGCAATCTTGTCAGAG
>TRINITY_DN88_c0_g1
GGTGGTTCTTCTGGCCACCATCGAGGGTCGTCTGGATTGCACCACGCCGCTGCTGCCCGGAGTGGTGTTTCGATGAATGAGTGAAGTGAGTACAACGCGTGAATCGCGTCTGATGTCAGAACGTTGACTGTGTTCCGAAGATTGGTGGATATCGTTCAGTTTTTTTTTCTGTTTTGAGATATTCCCGGATTAAGTGAAGCGCACAGAAGGAACCTGGAGTTAATTTTAGAACGACTGACTGCCAGCGGCCATAACATGTGCCTTGAAGATTCGCGAGTGCCACTAACCACCTGAAGCGACATTGCCATATTTTCCGAGTTACACGTGACGTGATCAGCAACAATGGACAACCCCGACTCCCCGGATTCGCTGGGAAGCGATCAACTTACCGTCGACTTGCTCAGTCCGGCGCCGAAGAGGAGGGCGGCATGTGACATGAGGAACAGGAGAGATGGGACTCCTGACGTTTTAGGGAAAAACACGAACAACAACGATGTGGGATTCGTGTTGATGGAGGATGAGTCCCCCGAAAACGGAACAGAAGAAGAAGATGAAGAACGACTGACTGCCAGCGGCCATGGTTCCTTAGCACTAAGCGGGAGCAGTCCTGGATACGGAGCTGGTGGTTCCTCTGGCCACCATCGAGGGTCATCTGGATTGCACCACGCCGCTGCAATGCAGCATCAGCTGCCGCAGCCTGACTTCCAGCCGGCATATTTCCCACCGACATTTCACCATCCACCTAGTCCGCCTCCTCAACAACATCTGGAGTACCTCACGGATCCGTATGGTAGCCTGCCCGGTTTGCACCATTACAACCAGTTAGGTCTGGGAAGGCCGAGGGATTCGGATCCTAACCATCATGTGGGCCAACTCGGTCATGGAGGAAGTTTTCCATACAGCTCAGGACCAGGGGGTGGTAGATCAGATTATTCTGTCAGTGTTTCACAACGCCCACACGATGACCCCTTGTCACTTCACCAGGCTCTTGGTCAGGCTGTTGATGAAGCTCAAGGTGGTCTAGATGACAATTCAGGATTTATCTCAGAAATACCTCCCCCTGGTCCTGAGTACTGAAAGGAATGAAAGGTGGTAAAGAACACGGTGTAGGTGCCATGGTATCACCCAGTGATGTCTTCTGTTCAGTACCAGGCCGACTCTCATTATTATCATCAACCTCAAAGTACAAAGTCACCGTGGGAGAAGTTCAACGACGTCTCTCACCTCCTGAATGTTTGAACGCATCTCTACTCGGTGGAGTTTTGAGACGGGCCAAGAGCAAGAATGGCGGAAGAATCCTGAGAGAAAAATTGGAAAAAATCGGTCTGAATCTGCCGGCAGGAAGGCGAAAAGCAGCTAATGTGACCCTCCTCACGTCCTTGGTCGAAGGCGAAGCCATCCATTTGGCCAGAGACTTCGGGTACGTCTGTGAAACAGAGTTCCCATCACGGCAAGTGGCCGAGTATCTTCTCAGGCAACACGGAGAGACCCCTAGGAGAAAGGAGCTCCTCCAAGCCACCAAACAGATAACGAAAGAGCTAATGGATCTCTTGAACCAAGACAGATCGCCCCTGTGCAATACACGGCCCCAAATCATCTTAGACCCTTCCATCCAGAGACATTTGACTCATTTTTCCCTCATAAGCCACGGCTTTGGCAGTCCGGCCATCGTTGCCGCTCTCACTGCCATACAGAACTTTCTGAGTGAATCGTTGAAACATTTAGACAAAGTGTTCCCCAACCAAAACACCCAACAAGGACAGCAAATGTTAGTGACGTCCACGTTAGATAAGGCCAAATTAGAGGACAAGAAGTGACCGTTCAGTAAATTCGTGTTTTTTGTGATCTAAAGATAGCGCTGATTTGGATACATTTTCAATGGCGTCGTCTAGTTTGTTTTTGAGACTTTGTTAAGTATTTTATTGTATTGTTTTTTTATTGTAATTATTCTGATTGATATAAGATATATTTTTTTCAAACAGTGCCAATACCGATCGTAAACATGTACATAAATTTGGGTAAATAATAAAGAAACATTCCGAA
>TRINITY_DN116_c0_g1
TGGTGAAGCATTCTGTTACTAGGTGCTCCCCCCAATCTCAACAGTGTTGGCAAGCCGGTATCTCAGGATGTAATATCAATGTGTTAAAACGAAATGTACAGCAGAAAAGTTAAACAGAGAACTACCAAGTTTGCCCCTTTTCCCTTCAATAAATAATGAAAGATCAATAAGAAACAAGAGGAGAGTAAGAAAGGATGCAAATCTTCGTGGCAACTTCATAGTCGTGTCTCTTGAAGTCTTGAAAAATTTGGCATTCTTTCAACTATCTAGCAAATGGTTACAGAATAATTTTCAATCTCTGATAGAGTGTTTCCTGAGCATTTCCCAAATAGTCCCAGAAATTTCACACTTTTCACGCTATCTCTCCCTGATTCAGTGTCAATTGATAAAATTTCAATTTTTGCTCTAAACAATTCATTCGCCATGAACCACTTCCGAATCATTCAAAGCCGCA
>TRINITY_DN45_c0_g2
TACCAGATAAATTTCCCGAACTCTCGATGCAAAGGGAAATCACCAGGTCTCATAGATAGGGAAATCATTAATTTATATAGTCATGCTATTTATGAACACTCAGTATTCTCTGAATTCATGAATATGATATTCCCAAATATCGATTAAAACATCTTATTGACGATTGTGGGTAGGCTACAAAATATGCTAATACATTAATCATGTTGTCATCTAATAATATTAATAATAAAAGGTTCATATTCAATAAATATCATGAAAAATTATAAGAAACTCTTCTTCACGAGTAACATTTTTTTGGAATGTTGGACATGCTGTGCTACCTCTTTTCCAAACATTCGGGGCAATAGTGAATATTGTTCGTTGAAAGCTCTGCATATTCTTGCAATAATTCTTCGGTACTCAGCATGTATGTAGAATAAATTCAAAATATCCATTCATATAATTTTCATTGATACTTTTTATTGGTTTATGGGTTCTCAACAGCATCAACGAACAATCAATAACAATTTATGAAAGGACGAATTTAGTTATCCAAAATTAACATCGAATTTAAGTTTCTGTGTTTTCTGTACAGATAAC
>TRINITY_DN42_c0_g1
TTGCAATATATATTCTGACGGAGAGATCATTAATAATTCTTAACACATTGTCAAGTTCAATAACTGCATCAATGCAAGTAAATAGAATCGATTACAACTGAAAATTCCAACTGGTTTACACACTTCGCTTTGAATGGATTATTATAATACGAGTAATGCGCAAATTAATGTATTCAGTGCGTTCCACTTTTTGACCGAGAAACTTTCATCATATTATATCCTATGCATAATAGGCTATTTGACGGAACGTCGAAACAAGTTAACTTTATGAAAATATTGTCCTTCTATTCTATTGATCGATATGATACCAGTCAACACTGAACACAAATTATAATTTATACAGGAACGTCGAAACAAGTTAACTTTGCTTTTGAGAAGGAAATATACGTGTATTAAATCATTGGGCATGTCTCTGCTTCAAGGATTAAGGATTGTTACAAGTTTGTTTATTTAAACTAGACGAACATTTTTTCAAGATTCCTTACTTTTCCAATGAAATAAAGGATGTTAGAAGAAAAGAACAACACATATCTGGATAATCAAAGTATAAATGTAGTTGAAAATCATACACTGCAAAATGGTACAAATCGGGAACCAATTTGTTTAAAATGCGTGAATCAATCAATTCATCAATATTTAATTCGTTAATATTCATTTCCGTTGACCTCGTATTAGAGAATTATCTTTATTGTACGCAAATTTGATTGCTAATGACCCCATAATAATAATAATAAAG
>TRINITY_DN53_c0_g1
GGATAAATAAAAGTGAACTATAAGCAGAAACAAAATATATCAAACAAACCAGCAATACAAAGACGCAGGAGAACCAGAAATTCAGTGCTACAAAAAAAAATTCTAATTGGAATTGTTTAGTGTTATTGATCTGTTTTCGAGCGGGTCTTGGCAGATATAGTAGCTGCTTCAATTAGTTTCTGGGTCTCCTTCACTGCTCTCGCGGAAAGCGTTGAGTCCTCCTTTGATCTAACCCTGGGAGGTTCAATTTGCTCCAGGTACAGGTTGTAATTGATTTCTTGGATAAGGGGTGGTTGGTGCGCTATTTGGCCCCACGATTGGTTCCTGTTGACTACTTTCGCAATCGAGAAACTGATAATTTAATATAAGGGATGAAAAATTACTCCCTGTATCCCGTTGCGAGTTGCTGATTTATTGTAGTTAAGCACATTGGTGTAACAATGCAACTTTCCAAATATGGTTATGATTCGATGAATACTTTCATTGCATATCCCATACAAAAAGATGATTCAAGCCCAAACAATTACATGAACAAACCGATATTTGATCAATTTCAGATTCTTCCATGTAAGCATGTCCTGCTAAGAGTTTTCCATTCACAGCCATGACCTCCCCATCAAGCGTGAGAACATGATGAGATGAGGATTGGAGATCTTGTTCATCCCTGCGAATATCCTCAGCATTCATAGTCATAAAACGTAGAACAAGCAAATTTATACTAGCAGCAACAACTGCTAAGCCGAATAGTATGAATACCAAGCTCAATGCAACATATCCTGGTTTGTCCTTCAAGGCATTGTCATTCTGAAGAGCTACATAATCTCCAAATCCTATTGTAGTTAAAGTGACAAAGCAATAATAGAAACTATCAAAATATGTCCATCCTTCATATCGGGAGAAGACTGCAGCACCCGTAGTGATTATTATCGACGAAAGCATTCCAGTTGCAAACATTAGATTCATTTCTGTTGCTTCTATTTTAACACAATTCAGATACTTTTTTATTTGGCGAATAACAATTGAAGCAAATTTATTGAGTCGTTCTCCTATACTTTGAAACATGACCAATCCCAAAGGAATGCCAACCATTGCATATCCCATACAAAAGGTAATGCCAATGAAAATGGGAAATGAATTACAGACAATAATGTCACAAAAACAACTCATTGTAGTGATGCATATCATAAGAATACTTGGAATCATGATGAGATTATCATAAATGTGGTATCGATATAATTTCAGTGATTTTTATTTCTAGGATATCATGTTATTCAGTCATGGCTCTAAAAGGGGACAATATAGAAGATGGATTCAAGACTTAAAAGATTCAAAACTTAAATAAAATGATTCACATGTTATATTACCCAGACCAGATTGATAAATAAACAACAAATACCTTATCAATTATATTATAGAATATCTAAAGTTTACCATTGCATATCCCATACAAAAAGCTTTTCCTCCTGCAGTTACTGGGGTTGAATGTCCATATCCTATCATAGCCAAAACAACAGTTGCAAAATAGAAGGCACCTGCAAACTTCCATTGTGGACCAGCTTTATGTGGTTTATATTCTGTTATCACCAATTCTATCATTCTATAATCCTCTTCAGAAATATTATATTTCTTTCTAAGGGAGTTAGAGGAAACTTTAAGTAATTCATCCCTTTTACTTTCTTCTTTCGACTCTAATGCATCAAAAACAGCTGCACCAATTAATAAATAAGTAAATGTACAAACTACCAGCGACAATGTTCGCACATTTTGTTTCTTCATTTTCGTGAACGTACATGAAAATAAGTTTAATTAATTCTAGAAATGTTTGGATTATTGTTCATTCCTTCTCTATTGATTTTTAAAATACATTACATTGAATATTCCATAGAAATATAGAATAACCATAGATTAACGAAGTATTTTACTGAAAATTAGTAAATCTGTGACTTATCTCTGCTACGGATATACAATGGAATATTCTAAGATACATTATATTCTATATTCTATTTTAAGATATATTTAGTGTTCTGTGTTATGGACCCTGCAGTATCCGTGATTTAAGGGTAGGGTGCGCCATCTTTTCGCCATTAGTGAATTTATTTGTCGTTTTATTCACGATTATATTCTTTTTTTAAATCAAATCCAACAATAGAAGCTGATTCGATCCCCAACATTGAAAACGATTAACTTTTCTCTTCTTCCTTTTTCACTATCACAGGTTTTTCTCCACCACAAAAACTTTCTTTTAAAATAATCATATTATCTGAAATTCATTTACATCTTCTTCGTTTTCTTGTTCTCCAGCTTAAAAAGTGAAAAATGGTAATAATTTACCTTTTCAAGTACGAAATACTCAAAAAATGGTAGGCTCACATTTAAAATTGC
>TRINITY_DN67_c0_g1
CCTCGTTATCCTTCAGACATGTTATTATTCCTGGATTCGGATGTCACGCAGTTAGCTATAGCTTTCCGCGTGGTGATGTCGGTTGTTGCCCGAAAACACATTGGGTCTTCCTGCTGAAACCACAAATGGATTGCTGGCTTCTGTTGTTGACTCTGTTTGTTTGTTGTTTCTTTCAAGTGTTGCACATCCTAACACTTGTTCACCGTACTGATGAGGGCCGAAAGCCCGAAACACGTGTCTACGGTTAGCATTTCTCTGTGAGGGACTGTCCTTATCCTTTTGTGCTTTGTTTTATGAACAAAAACCCTCGTTATCCTTTACACATGTGATTATCCCTGGACTCGGAATTCACGCAGGTAGCTATAGCTTCCTACGTGGTGATGTTGGTTGTTTCCCGAAAACCCATTGGGTCTTCCTGCTGAAACCTTATTTCTCTGAGAGGGACTGTCCTTATCCTTATGATTTGTTTTATGAACAATTACCCTCGTTATCCTTCCGACATGTTATTATTCCTGGATTCGGATGTCACGCAGTTAGCTATAGCTTTCCGCGTGGTGATGTCGGTTGTTGCCCGAAAACACATTGGGTCTTCCTGCTGAAACC
>TRINITY_DN83_c0_g1
CCTCACTGTTGTGTGAATGACAATTCAGTAGTCAATTTTAGGAATCAATGGATATGTTTATATCGTTAATATCTGATAATTTTTTCCAGAAGAACAAAGAGCTGATGAGTGAATTAATTTCCAATTGCAAGCTGAAAAACGGCTTTGGCACCAATATGAGTATTAGCAGAGGGACAATGCAATCCAGTTCATCACCAACCAGAGGCTCGGTGTCTCCTGATCAACCCAATCCTGCCGAACCCATTACAGAATCTCCAACCATGACCATCGGAAGAATTGGGTGGGCTCTAAGAATATTACTCTTGACTCGAAATACTTGCCTGAAGGATCGGAAAGTATCAGGTAGACTAATACGAAGATGCGCGCCCGGGACTGAATTGGTTGATTGGTTGTTAAGTTTGTCTTCTGGAATACATACGAGAGCACAAGCAGCAGGTATGTGGCAGTGTCTTCTGGAAGAAGGAGTTATATCACATGTCAATAAAGAGCAACCTTTCAAAGATAAATGCTTCCTCTATCGATTCTGGCAGGACGAAGAAGGAGCCACAGCACTTCCTCCCTTAGAAGATATTGCTACTGCGGAAGATCAGCTTCAAGAATCATTGGTTGTTCTTATGAGTAGAGGTCCAGATGCCGTTCTGAGAATGATCCTAAGAAAACCAAATCATGAGAGAACACCTGATGATTTGGAGACCATTTATGAAGAATTACTTCATATAAGGGCTTTAGCGCATCTTTCAAATTCAGTCAAACTGGTACTCCAGTTATGGGGGAAATATCTGTCTAAAACATTGATACAATGTCTTTGCAATAGCTCCAATACAAAAGTAATTGTATTCATACTTTTTCTTCAACTGTTATGTAACCTTTCAATTTATTCCTTTGTTCTAGTTCTTCTGGCATAAGGAGAGCATGATCTTTTTTAATAGGTTTAGCATCTTTCAAATTCAGTCAAACGAGAGCTGGCTTCTGTCGTTGTTTTTGAAGCACATCCTCGAGCTGGAACAGTCTTATTCCACCAGGGTGACGAAGGACGTTCATGGTATATAATCGTCAGAGGATCAGTCGATGTGGTCATCCACGGTAAAGGTACGGTAAATACCTTACACGAAGGCGATGATTTTGGAAAATTAGCACTGATAAATGATGCACCAAGGGCTGCCACAATTGTCTTGAGAGAAAATAATTGCCATTTTCTGAGAGTAGACAAGGAAAATTTCAATAGGATTCTTCGAGATGTGGAAGCTAACACAGTCAGACTCAAGGAACATGGCAAGGATGTGTTGATACTTGAGAAAATCAACACATCAACGAAACATTTTAGTACTAATTTCAAATATACTGTGATGGCAGGAACACCACAGAAAATGTTAGAGCATCTATTAGAAACCAGGTTAGATGGAAGAGGATGTGGAGGAAGCGGAGACAACTCAACTTATTCAGCATCGGATTCATTTTTAGACGATTTTCTACTGACACATATCGTTTTCTTACCAACACATCAACTAGTAGAGGAACTGGACAGATACTATCATATAGATCAACTAAATCAAGATAGAGAGTTTATTTTAGCCTGTAAACGAAGAGTTATTCAGTTCGTATACAGATGGGTTACCACGATTCGCCATCCTGTGTTCGAAGATGAGTCTGCAGTCGTATTCTTGGAAGACTTGGCACAAGATTTGGAGGCAGATTGCAACCAATTGAATTCTCTACAAGAAGAGGCCACTTTAATGCATCACGTCATTTCACAACTTAGGAGGTATCAAGATGATCGAAGAGCTCATGAGGGCCAAAAATGGAAACTTCCTCCACAAGGCCAACCTATCAGTTTATTTGCTGGTGGAGCAATAAATAGGACCATTATCATGCCACAGGACGATATCATTTTCAGAGTATACTGTGCGGACCACACCTATTGTACTTTAAGACTTCCTGTGGACACACCGGCGGAAACGATAAAATTGGTATCTGCTG
>TRINITY_DN17_c0_g1
ACTTGCCGTTCCATCGGATTCATCTCGGATGATGTGGGTCTAGATGCAGATAACTGCAAGGTCTTAGTCAACATCGAGCAGCAGAGCCCGGATATTGCCCAAGGTGTCCATGGCCATTTCACTAAGCGACCTGAGGAAATTGGTGCTGGTGACCAGGGTCACATGTTTGGCTATGCCACAGATGAGACCCCAGAATTGATGCCCCTTAGTCACGTCCTTGCAACTAAGCTCGGCGCTCGTCTCACTGAGGTGAGGAAGAATGGTACCTGCCCATGGTTGAGACCTGACGGTAAGACCCAAGTTACTGTGGAGTACTACAATGACAATGGTGCCATGGTTCCTGTTCGAGTCCACACAGTTCTCATCTCCACCCAGCACGATGAAACTGTCACGAACGATGAGATTGCAGCTGACCTTAAGGAGCATGTCATCAAGCCTGTGATCCCCGAGAAGTACCTTGATGAGAAGACCATCTTCCACCGCAATCCCTCTGGTCGCTTCGTCATTG
>TRINITY_DN12_c0_g1
ATTTCATCGTTTTCATCTCGGGCTGATGTAAATACTATATTGTTAAACGAGTGAATCATAGTGTTATAGTGATTATAGTACTCTTTTGCAAGAGTTTGCATAAAACGTTCCACATTGTCTTCATAGTTGCTTTTTATATTCGGTCCCGTCTTTCTTTTTTATATTTACCCCCCCATCTTTTAATATAAACGTCAATTCTTTCAAGCTCTTATGTACATTCAATTCATATTTTCGTTCGCAGCAAAAATTCCAAATATATTTGTAACTATGTCGTATTTCTGAGAATTTTCTTTGATAGGCGCATTTATACTTTGAATGCCTAGGTTAGGTTTTTTCTCATTTTATTAACCGATTTTGTTTTGTCGATTTGAATTTTCTACGATGAAATAATAAACCATGTTGTTTAAATTGCAGTGATTTGAGATATTTCAGAGAATAGGAGGAAATACATAGTAAGCCCAATGGCTTACTATGTAACATTGCG
>TRINITY_DN169_c0_g1
GGTCATCAAATTTAGGGCATCCAACATTTACCTGAAGATGTGGTAGAAGAACACCATTCTTCTACCACATCTGAGAACCATTCTCATGCCTCTATTCAGAATTGTTTGTAGGTAGTCTAGTGATGATATTCGATTCCAAATTAAATGAGAGAGACGTTCAATAATCTAAATGTAGTAGAACGATTGACCTGAAAAGATTGCTG
>TRINITY_DN117_c0_g1
GAAGAAAATGATATGAACAACAATAATGATAGTTCAAATAAAGATTATTCTGGCTTAATTTGCCAGGAAAATTTTGAAGAAGATTGGATACAATGTCAGAAATGTAAAGAATGGGCACATGAAGACTGCGCAGACCTCGATTTGAAGTCATCTTTTTATACATGCGACTTTTGTAAAGATTAACCCAGTTAAATTGCTTCTTTCAATAAAGT
>TRINITY_DN24_c0_g1
CGTTAAGTGTATCGAGTTCTGCTATTGCATCATCGAATGCCTAAAATATCAAATATAAAATTATAGTCAAGTAGAAATAAAATTCAATGAATTTCTGATAATAAAGGGTTATCCATTTTGTGGTTCCGAAAGTAAACGTAAGAAAAAACACTTTCATTGAGAACATCGAAATTTTAATTTCAATACACAGGGTGTTCTTTAATTGGAGGAAAATGTTATATGCTAATTTTAAGTGCAAGTCTACAGTGTGATATTTTTCAGGAACAGCGGCCGCTCTTTCCCTCAGAACTTTTTTTTTCATACATCAACGGTAGTTTAGAAAAATGTAAAAAGAAACTTGTCCAGTACTATACTTTTTGGTATCTTATAGTTTTGTTGTATATGCTACAGACTAAGTATTGATAATAAGTTTTCACACATTCAGCAGTGAATAAACGATCCAAATTTTTGAATAAATAACCTTCAACATGACAGTTCTGTTTTACATAATGTAAATGGAACAAGACTGTAAAGTCCGG
>TRINITY_DN68_c0_g1
TCTGATTGTCAAGCACGAAACTCAAAATTTCCGTACGAAATTTTTGGAAATGATCGATTAGTATTAGGAAATAAACCGCCCAAAATTTTCGGCCTGAAAATGTTAGTAATCTACAACGGAGAGTGTTACGACAAAATTTTCAGCCTGAAAATGCTAGTGATCTACAACGGAGAGTGTTACGACAAAAACACCCTTCTATCGCATCTGAATAAAGTTGTGAAGCAGATAGAGGCAGTTGGTGATGACGATATGCCGTTAGAAGAACACAAGGCTTGTTGGATGCCATTAGAAGAACACAAGGCTTGTTGTTTGCCAAACGCCACCTGTCAAAGAAAATGCGAAAAATGTTGCGTTTTGAACCATCATGTAGAACCTCCCATTTGCCATTGTTTCGAGAACAATCACCATTGTTGTAGCAATTGCATCCCTCCTGGAATCACAGAGATATGCGAACGTGAGGAATGTTCGAACTGCCATCATCATGCGCACCCCACTATATGTCATCATCATCCTGATCGAAAGTGCATATCTATTCGAGAGAAAGCCAAACCTCAACTAACAAACAGCTCATCTTGTCCTTGTTGCAAAAGGTGTGTAAAAAACGCTTGCTTGATCCTACCCCAAATATGCAAATAAAAACGCTTGCGTGATCCTACCCCAAATATGCAAAAGTAATGACACCAAATGTAAGCCAATTCCTTGTATCACATTCCCAGAACCTGAAAAATTGCCAAAGTGCAAAGAAAAAGAGGAGAATTACAAAGGCAACCCATTGAAAGAAGAGAATTACAAAGGCAACCCATTCGTGATCAAAGATGATAACGAACAGAGATGTAAAATAGCTCATCAAAGTAAAAATGTGGCAGTAATACAACCATTATTATCATCCAAAAAATGTACATGTGAAAATTGTCAGTGTGTTTTGAAATGTGCGAATATCAAAACTTGCAGCATATGTGCGTGTAATAAAACGAATGGTTTGCAGGATAATTGTAAACTTTGTCATATGCCTAGAGGTAGGCTGGGATATTTGAAAACCAATAAATGAGTTCAAGA
>TRINITY_DN112_c0_g1
CGGATACGGAATAAAAGTGTCAAGTTCACGAATATTTCTCGGTAATTATGTTTCCGAGATGCCTCTTTCTGAGAAGACACAATTCCTTGTCTCTATTAATTCTGCTTTATACGAAATGGAGTAAACTGAATGAAATTGTTGAATTCATGTTGATCGCGTAACAAGAACCAGAGGTATTTCAAGGAGAAGAACGAGAAAAAACTCCTAAATTTATAGTGAATACAAAACTGAAGTATCAATTTGTATAATAAAATTTTCAAGCTCCTCGCAAAATTTTAAACGGTTTATATTCAATTCCAACAGCATATTGGAAAAGAAATACTAATATTCCAGTTGCGAGTGCATAGATTAAAAAGTTCGAACTATTTGTGAAATTTTGTTATGGTGCCTCCTTCAAAAGTTAAGACCATGGAGAATTGAAGCAGAATCTCGAAGAAAAAGTAATTTTTCATTGACAAAAGAACTAGTTTCAGAATACGATCTTCTACAAGCTGTTGAAATCCCCTTCCCCACCTTCGACGAGGAGTCTGTGAAAGTGTCCTGCGCGAGTCTTAATGCACGTGCTATACCGGCATAGTAGCCACGTGTTGTGACGTATGAAAGCATGGTGTCTTGTGCAGTGTGCGCATAAGGGATCTTATCGTAGTGAACATTGGCGAGAATTCTGCCGTAGCGATGGGACGTTCTAGACTGAGTTATCACATTTTCGTGTTCCATTTCTTGTTATGTTGGTTGACATCATCAACGAATGGAGGAGACCCCTTTTTTCTTCCTGCTTCTTTTATCTTAGGCGACAGTTCTTCAGCTGTTTCAGAATACGACCTTCTGCAAGCTGTTGAAATCCCCTTCCCAGACCAGAAAAACCAGTATATCGACAATGATGGTCACGACAGATTTCCAGCGTTCGGTTTCAGGACCGGCAGTAATGTAAGGGTTGCTTTTCGACAGATACTTCCGGAGAGGATGCCAACAGAGTTCGCTATTTGGATCAGCGCGAAGATGAAATCCAGGAGAGGATGCCAACAGAGTTCGCTATTTGGATCAGCGCGAAGATGAAATCCAGGAGAGGAGGATTCCTGTTCGCTGTTATGAACCCCTATGAGACGGTGGTACAGCTTGGCGTCAAAATATCCCCTGAGGGATTCACGAACACCGTAATATCGCTCTTCTACTCGAATGCCTCGTCCATCAACTCTCATGCGATCGCCAACTTCAGCCTGCCCAGATTCCACGGCAAATGGGCCAGATTTGCATTCCGGGTGTCCACGGATAATGTGACCCTCTTCTTCAATTGCAACGAAGTACAATCGGTCAGCGTCAAGAGGGAGCCAGTGGGACTGCAATTCGACTCGGCCTCGACCCTCTACATCGCCCAGGCCGGTCCGAACCTCAGCGAACCCTTCGACCGAACCTCAGCGAACCCTTCGAGGGCGCTTTGGATCAACTGAAGATATTGGTCGACCCAAATATGGCTTCAGAGCAGTGTAAGACATACTTCAAGGGTTTTCAGTCAGAAGAAGAGTCAAATGACGACAATGAAATTCCAGTTGTCGAGAGTACCGAATTCGGTTTTCGAGAGTACCGAATTCGGTTTGCCCTCGGGAAGCGGCGTTTATCCCGAAGGCAGCGGTTACGAAGAATTCCCACCACCACCTCCTCCGCCACCAGATGGTAAGAATTGTAATTATGGCTGTGAGAATTGTTGCAATGAAATTTTGTCTTCCTACAATGCAGCCGGATTAGGATATCGAGGAGAGAAAGGCGACAGGGGCCCAAGGGGACCACCTGGCGAATCAATCCGAGGACCACCTGGCCCACCTGGACTTCAAGGACCACCAGGACCCGAGGGTGTCTGCTCCTGCAATATTACTGGCATCCTCAGCTCTTATATGAAAGAAAATAAAAAATACACTAGTTTTACCGAAATCAAAGAGGGACCGCAAGGTCCTCCTGGTTTACCAGGAGTCATTGGGGAGAGAGGCCCTGTTGGTCCTCCTGGTCCTAAAGGTGATCGTGGTGAAAAGGGGTCCACAGGTATTGATGGCCAGCCTGGTACCAAAGGGGAACCAGGCAGGGATGGACTCCCTGGTGTTGCAGGACCCCCTGGGCCTCCTGGACCGCCTGGACCTATCGAATTCGAAAATGTTGATGAAACAAATGTTGGAGGCGGTCTTGTTAGACCTGGAGTACCAGGAACCAAAGGAGAACCTGGTATGCCTGGAATGAGAGGAGAAAAGGGACCCGTGGGTCCTAAAGGTCATAAAGGCGATGGTGGCACTAAAGGTGAAAGAGGGGATCGAGGACTTCCAGGAGACAAGGGACCTGTAGGTCCAAAGGGCGATAGAGGAAATCCTGGATTGGATGGTCTTCCTGGGACTTCAGGTAAACCTGGTGATAAAGGTGACAAAGGTGATCAAGGCAAACCTGGTCCACCTGGTGTGCCTGGAATAACATTCAATACGGACGATTCGATGGGAATTGCACCCGCTATCCCAGGTCCCAAAGGGGAACCAGGCGACAAAGGATCAAGAGGTGATAAAGGGGAAAGAGGAGAGGCTGGATTTCCCGGAGTACCTGGTTCAATTGGTCCTGTTGGAAGGGTGGGAGAAAAAGGTGATCGAGGTACTGACGGTGCCATGGGTCCCGTTGGTGGACCAGGCTCAAAAGGTGAAAAGGGAGAGCGAGGACCGCCTGGTGCTGTCATTATGCCTGATGGCAATGAGGAAGTAATTACTCTGAAGGGTGAAAAAGGAGATCCGGGCAGGAGGGGAAGGAGAGGAAAACCCGGACCTCCGGGGCCGCCAGCAAAGTCATCATCGTCGGACATTTGGACAAGTAAAGGAGACAAGGGCGAAAGAGGAAATGACGGTTCCCCAGGCAGAGATGGCAAAACTGGCCCTGCAGGTCCTCCAGGTCCTCCTGGGCCTTCTAGTGGGGGTAATGAAGACATAATGCGTTACATTCCGGGTCCACCAGGACCACCTGGACCTCCAGGACCACCAGGAACATCAGTTCAGGGTCCCAAAGGTGAACCAGGATCTTCATTCTATGGCGAGACAACTTACAATCTAAGACCCGGATCAAGGACTAGCTTGGAAGAGCTCAGGGCTCTACGGGAGTTGAAGGAATTGAAGGATTCGAAGTCAGGTCGAGCGACACCCGTTCCTCCTCGAGCGACACCCGTTCCTCCCACCTCAAAGGAAGATGATCTACCCAGGCAAATTGTGCCCGGAGCTGTGTCATTCCAAGACAGGGCTGCCATGATGAAAATGACTTCCATCAGTCCCGTGGGAACGATAGCGTATATTATAGAGGAAGAAGCGATATTAGTAAGGGTCAATAATGGTTGGCAATACATTGCGCTGGGATCTCTATTACCTGTGACCACCCCCGCACCGCCAACTACAAATAACCCGCATCTGCGGCCGCCTTTTGAAGTTAGCAACCTTATAAATAACATGGCCAAACCTCCCGATGTTTCCAATTGGCATCCAAGAATGTTACGTATGGGTGCGCTCAATGAACCCTACACAGGAGACGTCCATGGAGTCAGTGGTGCAGACTACGCTTGTTACCGTGAGGCACGAAGAGCAGGTTTGAGAGGAACCTTCAGAGCCTATTTATCCTCGAGGGTACAAAACGTTGACTCCATCGTGAGACAAGCAGACAGAAAATTACCTGTGTCCAACCTCCGAGGTGAGATTCTTTTCAATTCCTGGGCCGAAATGTATAATGGAGATGGTGCTCCTTTTCCCCACGCCCCCAGAATATATTCCTTCAGCGGCAAGAACGTTCTCACAGATTTATCTTGGCCACATAAAGTTGTATGGCATGGCGCACTGCTGAATGGAGAAAGGGCCTTAGACACATCCTGCGATGCTTGGCATTCGTCTTCCTGCGATGCTTGGCATTCGTCCTCGAAAGATAAGGTCGGCCTGGCAGGATCCCTGAAAGGCCCCAGGTTACTCGAACAAACTTCCTACTCGTGTGACAAGCGTCTGATTCTGCTGTGTATCGAGGCAACAACCGAGCTCTTCGTTCAGAGGAAGCGAAGAGATCTAGATGATATCAGGTACTCATATCACGATGATATCATGAGTGAAGAAGAATACAATAAGTATCTGCAGTCCATTCATTGAAGATAATCTCTACTAGGATGGACGAACTCATTGCTATCGGCAGGAAGATTGGTCATCACATAAATATAACGAATTGAACATAAGTTACCTTTCGTAATGTTCCATCCAATGTTTTTTGTGTTATGTCGTGAAATATAGCCAGTGGACGATAAGTGTAAATTTTAATTTGAAGTATCCGAATTATCGTCATTTTTGATGAGTTACTTTTTCAAATTTGAAATGATACGGTGATCTGTCAGTTTTATCAATTGTTCATTCATGCTAATATTTTCAACTGTAGAAAATGTTTCATTCAAGTTCTTCTAATTCAGTGCAAAGAATCAAGAATGAAACTTGCGTTCATGCTCTTCGGTTTCACGAAACGAATAGAAAATATACATAACAGTAACCTATGGATTCTCAATGAAATAACTAACCGATCACCGTTTCTTTTTTACATATTGTGCAAATTCGATGAGTTACTCTTTCAAATTTGAAATGATGCGGTGATCTGTCAGTTTTATCAACTGTTCATTCATGCTAAAAATTTCAAGTGTAGAAAATGTTCAAAAAATTCAGAATAAAACTTGCGTTCATTCACTTCGGTTTCACGATAGGAATAGAATATATACATAGCAGTAATTTATGGGTTCTCAATAAAATAACTAACAGATCACCTTTTCTTTTTTTACATATTGTGCAAATTCATCACCAATAAAAGCTCAGTATTCACTAATATAATGTTATTGTTATAATAGACTGAAAGTTAAGGCTAACTTCGTATTACCATTAACCCTACACTTCTCGAATTTTGTTTTTTGTTGAAAAAAATATAATTTCGATTCATAGTATTGAGAGGAAGTATAAAAAAATAATAAAAAAATTCTAGAGTTTGTATTAAGTTTTATTTTTGAAAAACATTAGTTGTATCAAATTTGATACATAATGCATATGAGAATACATTTTCAAGAATTGTGTAAATTAACAAAACAATTATTATTCTTGTTGAGACACAAATGAACACCACATTTTGAACATTTCAAATGAGAGAATGATTTGCAAGAAGGAAATTTAAATCTTTGTCTCCACATCATCATAGGTAGGCCAGTGACTTTGTCTCTACATCATCATAGGTAGGCCAGTGGCCAATAGAATCGGTCCTGACGTCCTTCGGAGGAACATGCGAAAACACTGTGGACTTTTTCTTTTTCGCAACAAGCATATTTTCGACGGAATCCTTGGATGGTCTACCTCGTTTCTTGTTTCCATTTTGTGACTTACAGAGTCATTCTGCTATTTCTAGCCGAACATCAACCTGTTTGAGCTCTTGCTTACCAAACCTCTTGTGGAGCAACCATGTATTTACTAAGGTCATGTCGACTAAATGGTAAAAAAGACCAATATACCATTTCTTAGATCTAATTTTAATTTTATTTCTGCCAATATAACTGTCCATGGCATCAACGCCTCCCATATGAGCATTGTATTCGGGACTAGGTTTGGACACTCAACGGGACTAGGTTTGGACACTCAATATTCACATACTTTTTTGATTTTCTGTCTGGTTTGGACACATACTTTTTTGATTTTCTGTCCCACCTTTTCACTTCTTTTGGAGGCATTTTCCCTTTGAATGTTGAAAGAAAAATAACTGGCTCAATTGAAAGAAAAATAACTGGCTCATTATCTAGCCATACCACAGATGTTATGTCAACTCCATCTACAGATGTTATGTCAACTCCATCGATATTGCGGATATATTCATGCGAAGGGTCTCTAGGTTCTTTCATCAACTAGATATATTCATGCGAAGAGTCTCTAGGTTCTTTCATCAACTCTTTTTCAATTCAAATATGCGCTATGTATCAAATTTGATACAACTGAAATTATGTCGAATATAATAATATCACATGGTATAAATGAATGAAATTATGTTATATTTGATATATCTCACCTTTATCCAAGTAAAAACATTTTTTATAATGCAACTTTACGAAAATTCGAAGGATAAACAAATCTGAATCACGAAGGATAAACAAATCTGAATCACCTCACACTGGATATGATATCAACCAGCTACCATTTTGAAACATAAACATGCCACAGATGGTATTAGCGCGCGGAAATGTATTATGAAACGTATTGAATCTTGAAATAAGGATGTATCAAATATGATACGGTGCGTTATATGTAAGAAATTGCTAAATAAGATAACTAATGTTAGAAATTGCTAAATAAGATAACTTTAAATGAAGTTTATTTGGTTGTATCTGATTTGATACAATAGGCAGTGTAGGGTTAAGTAGAGTTCGATACCCAATGAAATTACACAGTTTTTCTTTTTTTTCTGCAAGTGTATGAAATGAAGTTTATCAGAACTTCGTATTACCATTAAGTATTGAAGTAGAGTACGATACCCAATGGAATTATACAGTTTTTGTTTTTTTCTTCAACAAGTGTATGAAATGAAGTTTATCAAAGAAGAATTTGGATAACTGTATTTTTACTTCAATTATAGATTTCAGCCTGCAAAATTGTTTCACATAAGTCATGATTGAAAAAAACAGAAATAATATGTATGGCCTAACTCTTTCGGATATAATACGATCGCAAAAGTTTTCGATGCATTTGTTCACTTCTGTTCTGATTGAAAAAAAGTAAATTCTGACTTATCTGATCTTAGCAGAACTATATAAAATGAAGAGAGCTCAGTTTGTATCAAAAATACAAATTTGATGGGAAATATACCTGTATTTCCAACTAAACAGAAATCTGGATTTAGATGGCCATCTATTGAATTTTCCAGGTATATGAAAAGTGCTTATATGTTGTCATTAACTTTCAGTCTTTATTAGGTAGGTATAAGTTCATTACTACGAAATTTGGATAACTGTATTTTTGCTTTAATTATAGATTTCAGTCTGCAAAATTGTTTCACACAAGTCATGGTGAAGAAAAACAGAAGGAATATGTATGGTCTAACTCTTTTGGATATAATTAAAACAATCCAAAATACGATCCCTCTTCTACTCAAAATGTCGCAAAAGTTTTCGAAGAATTTTGAATACTTCTGTTCTGATTGAAAATATGTAAATTATGACTTGTCTGATCTTAGCAGAACTCTAGAAAATGAAGAGAAGCTCAGTGTGTATCAAAAATTCGAATTTGCTAGGAAATATACCCGTATCTTACTAAACTGAAATCCGCATTTTTATGGCCATCTGATAAATTTTTAGTAGATTTTGAGGAGTATGAAAAATGCTTACTTACTTCAATTTGAATAAATAAAACGAAGCTGTGAGTAGAGTTGTCACTAACTTTCAGTCTTTATTATGTAGGTATAAGTTCATTACTACGTTCAGTCATTTTTTTGTCATGAGATCGATATATTGAATGTATGCAGTCATGAGAAGTTTGAGTGACGATCGATATATTGAATGTATGCATCTGTTTAATGAATTTCACATAGCATTAATTACCAAAGTCATAATATCGTTCTCAGCATGGAAGTTTTTCTTTTCGATTATTATGCCATGTAGCTTAGACTTCGATTTCGGCGAAAATTTTCATTTGATACAATATTTTCGATTGTTCGAATGAATATAATAAATAAAGGAGCGTTCTATTTTATTTTTCAACATGAAAATCAAGTAGTTCCTATAATATCGGTTTAATCAATTTTACATATTATTAGTTATCATGATCATTATATCTTTTTCACCAAGGAAGTTTTTCTTTTCAATTATTCTGCCATGTAGCTTAGACTTTCATTTCGGCGAAAGTTTTCATCGGATACAATATTTTTAATTGTTCAAAAAAATATAATAAATGAAGTATCGTTCTATTCTATTTTTCAACATGAGAATCAAGTAGTTCCTATAATATCGGTCTAATTAATTTCATTCATTAACTATTCTAGCGCTTAGAATTTCAATGAAGTCAACAGACGTTTTAAGACTGATGAATTGCATTTCCATCTAAATTCCCTCCAGAACACAAGAACGGAAATCCTTCAAGTTTCAATTTCGCAATCAACTCTTTATGAATAAACCTTTCGCGATGCTGAAATTGAAAGATATCACAATTAGGAGCCTTTTTCTGTGTAAATTAAAGGGTAGGCAGAGTCTATTGTGGAGCTTGTGCGGTAGTAGATAAAATGAATTCAGCAATCGTATTTAGGCAGCTTCCTCTGATTTAATAATTAGCCATTAAAGAAAATTCCCTCTCCGCCTCGTTAAATGGAAATGAATAACTCATCAATTTTCGCTGTTTTGCCTCTTTTCGTTCAGCTTGCAGGCAACAATTTTTTATGGTTAATGGCAATCAAATAAATTCTTATGTGCTGGAATGATCCACTGGATCTGAATTTTTAATTCGATTCCATAACTTCATTATTTGGAAATATTCATAATTTCCGAATCTATATATTCAATTCGGGTTGTCAATCTTTGCATTCAAAGAAAAAATCAATGAAACATAATCTGACCACCCTATCGATGAAACATAATCTGACCACCCTTCAATGAAACATAATCTGACCACCCTATCTATTCTTTCATTTCAACTTTTCTTTCAGACTGTGTTCATAAGTACTTCTTATAAAATTTGAATTAAGGTTTATTTTGGGATTGCATCAATTTTTTCATTATGAACTTTTTTTATTTTGGGATTGCATCAATTCTTTCATTTCAACTTTTCTTTCAGACTGTGTTCATAAGTACTTCTTATAAAATTTGAATTAAGGTTTATTTTGGGATTGCATCAATTTGAATAAAATTCGAAATATGATTTCTACTTTTTTATCACATCAATTTTGACTCAACTGATTCTTATATATTCTTTATATACCATGGAACTTACATATCCATATGACATATCATGTTAACAAAACGATGCATACTTTCAGTTTTTTCATTCATTT
>TRINITY_DN10_c0_g2
ATGGCTTGATATGGAGTCTAGGCGTGAACTGCATGCTGCTGTGTTGTTCCATTCGGTTCTTATAAATAAGTGTCCACCGTATCTATATAATAAGGTTCGTTTTCGTACTGATGTCCATTCTCTGAACTTAAGATTTAGGGGACTTCTTTCTCCACCACAGCATTCTACAGCTTCATTCACCCGTTCCTTCTCATACAGAATTTATCTGCTTTATAACCG
>TRINITY_DN10_c0_g1
ATGCTGTGTCTGAAGATATGCAGATTATTTTAAATGGTGAGCGGATTCAATGTGTAGATGAGTGTATTGATTTGGGTGTCCTTATAGACAAGGAGCTTCGATTCAGTGGTCATGTTCAGTCTTGTATTCAAAAGGCTTATGCTAGTCTGAGGATGCTTTATCCTCATAGGCACTCTCTCTCGACAAAACTTAAAATTTTGCTCACAGATGCTTTGGTCTTGAGTCACTTCAATTACTGTGACGCAGTTTACGGGCCATGTTTAACTAGGGTAGATTGTGACAGGATACAGAGAGTACAAAGATCTTGCCTTCGATTCATTTATGGTATAAGGAAATATGATCCTGTTATACATAAACTTAAGACATG
>TRINITY_DN175_c0_g1
AAAGAGAAGAGTTTGTTGAATCCATAGACTATGCTCAAAACATGAATATTCCCATTAATTCAAGGGATAGAGGCTTTTATCAAATCTGGCAATAATAATCCCGAAATGACATTATTCGCATACGCATATAAGAATTGAATTATTGACCCGAAAGTTATTTCCTGAACTTCATCTTTAACCTGGTAAATTTCATTTCCCTCTATATAGGCAGTCTGACATGGAA
>TRINITY_DN4_c0_g1
GGCCAATTGAAAAGTCCCCGTTCTGATGCACAGCGGTGCACGCGGTGCCGCGCGAGCTCACAATCGATCAAAAGCAACAACGTGTTAATGATTCTGAGCAGTGTTTGAAGCTGTTTAAGTGCAATAAACCTGAATTTTTGCTTCGATATGTGACAATCGATGGAATATGCCTCCATAATTTCACTCCGGAGTCCAATGGGCAGTCAGTTGAGTGGACTGCACATGATGAACCGAGTACAAAGCGAGGAAAAGCACAACAATCAGCTGGAAAGGTTATACCATCAGTATTCTGGGATGCGCAAGGTATAATATTCATTGATTTCCTCCAAAAGGGCCAGACCATCAACAACGATTATTATATAACATTATTGGATCGTTTGAAGGATGAAATTAAAAAAACGGCACCATTTGAAGAAAAGAAAGATGCTGTTTCATCAAGACAATGCGCCGTATCGCGAAGCATTTAAAACAATGGCAAAATTG
>TRINITY_DN63_c0_g2
ATTAACTATAATGCATTTTCGATAATATCAAATAAACACTTCTCTCAGTGTATATAATACTATAGTTAATTCGTCAATCTTACTTGTTTCCCCTAGTTCATCGGCAATTCTACTCCATTCTCTATCCACCAACAGTCGATTATGATATCTTTTATCAGTCTTGTCCCAGAGTATACTGGAATTTCTAACAGCCAGTATTAAAACTTCGTTTAAATCATTCATTGTAGAGCGGTCGAAGCAAACGTGCCTGCATCAACAAGAACTACTGAAGTTCGCGCGTATTCCGCTTGGAAATATCAAACAATTTGATCGCCGACAGAGCGCGAAATTCGGCTGAAACAGTTTTACGACCGATACGACTGCACGTAGG
>TRINITY_DN91_c0_g1
AAATAATCAAGAATAATCACCAAAAATATAAATTATAAAGTTAAGCAGTATCTCAAAAAGTAAAGGGAATGTTTTCAGTAAAAACTATTGTGAATTATTGAAATTATCACTTAAGGTCCAAAAAATACTTGAACCAAATGAGCAAATAGCTATATGAAGAGATCTCCAAATTCAAGTTAAGATTGAAAACATCCATTTGAATAATTTTTTTAAATCTTTTGAACTAAACTGATATAATAAAATAAAATTATTCATTAAAATTGAGTAAAACATTACTATTGATATAATTGACATTACCTTTCTGAAATTGAGTAAAACTATCGATATAATTGACATTACCTTTCTAAATGGCACGTTTGTATTTTTACTCAATAATTACACATAAAAAAAACAGCTGTCAAAAGCCATAAATTTCATTGCAGATACCTATTTTTACTCAATAATTACATATACAAAAAACAGCTGTCAAAAACGCCATAAATTTCATTGCAGATACGATACTCCCAAAAACTGAGTGTACAGTAATAAATTATACCACTTTTGAATTTATTAAAAACATTTTTAACTTAAATTAATTAAATAGGAACAGTTATTACTTATAGAAACAACTCAATTTTTGCTTCTGATGTTAGTGTCAGTACCTGGATATTCAACATTTTTTTTAAAGCAGAAAGCTTTAAGCAATTTGGAATGTACAATACAGTAAGTATTCTTCTAAAGTTCGGTTGTTATGTTATTCGAAATTGCTTGTACCCTTTTAGCATTGCAGCTCTTGCATAACACATGACCATCCAGAGGGTAGCAACCTCTTCCTTCAGCTTCTGATGAAAGCACTAGACCGCAATCCTCACACTTGTAACACTGAACGTGGAAACTATGATCAAGAGCAACCACTCGAACAGTTTCTTCTTCACCTGGTTCTGGCATTATTGGCTGCTTGCATACCCAACATCTTGGAGCAAATATTTTATGGAAATCTTCAATACAGTGTACTCTATTTGTAGCATCAACTGTAAAAGGTATTCCATCCAAGCTTTTCCCACAGACAACACAACAGAAACAACCGGGATGATATGGTTTACCAGTTGCTCTCAAGATCCTATCCATGATAGGCTTTTGGCAAACGCAGCACTTTTCCAAAGTGTTAAAGTAATCTTCTTCACAGTAGGGGATTCTTGGGAACTAACTATACACCTCCAAAAAGATATTCTCAAAAATCATACTTTGCTTTTTCTTTAGAAATATTCGAGGTGTATTCTTGTAATTTGGCAGAATGGTATAATTCTTCACGAGAAATATCAAAAATCCATAAAAATTTTCACATTTTCATTTGGAGAAAGTAATCTTCTTCACAGTAGGGCTTACCATTCAATGCGTAAAATGGTTTTCCCTGTAGGTTTACTGCACACTGATGGCAAGTGAAACATTTGGTGTGATATAGTTTAGACATAGCTGTACAACCATTACTTGCGCCAACAATCTTTTCTTTGCATTTTGAACAATGACCATAAGTATCTAAAATCTCGTTATCATCGTTCTCAAGACCCTGAACAAGAAGATCAGTCAAACTATCAACTTCTTGATCTTTGTTCAATCCCATCCTGCTAGCTGATTGAGATGGACCAGTCATTACACTGTTGCTGCCACTGACATATGGGGCATACAGAGAATAGTTAGAGCGAGAGGACAGCTGGCTAGGGGGCCTTGGGTTGATTGGTTCATAGATTGATTCATAAGTTGAGGAAGCCTGAAACGACCGTGATAAGTAATTCAACAAGTAATTCATCGATTCAATATTAGGCCCAATACGTTCTATCAAGAAAATACTGGGAATTGATCATTTCAAAAGACCTCTAACTCTAAGGAATAAGTGATCCCATTCCATAAGTGTGGACGAATTTCCATATCCAAAATCAGAGTCGGCGTACTGAGGAAACAGAAAATTATTTTTATAAATCAATATGAGTTGAACAATGAAAAGAGTTGAGAAGTAAAATATGCGTAAATTATTTTAGACTCTCTTCATTGTTGAATTTTTTACGTCCTTTCTTACCTGTGATCCCATTCCATAAGTGCTGATCCCATTCCATAAGTGCTGTAATCCTGACCTCGTCCAGTAGCCCTCCTTTGACCTCGTCCAGTAGCCCTCCTCAACTCGCTGTAGCTAGAGCTTACAGGAGATGGTGGTGCAATTAGATCCTCAGGAGGTGGTGGTAAATTAGTGTTCACTGTACATGGTTGATAATCTGCTAGGTTAGAAGTTAGTGGGGGTGGTGGAGGTGGCAAATCATCAGCACCTATGAATTTATATTATTTATTAATATTTGGCCGTTATGAGTATATTCAAAGACAGCAGATAGTAGAGTGAAATTAATCCATTTCCATATGGGGGAGCAGGAGATCCTATATTCAAGTTGCTATACATGCTACCTCCTCTTGGAGAATGTATCAAGTTAGAGTAAACTAGGGGTTCCGGTTTGCCTCTATGTCCAGTCTGAATATTACTATAAGTAACTTGATCAGACCTTTTATCGTAAGCTCTTTGACCTACAGCTGACCCGCCCATAGTTGAAACAGCAGATGGAGATGTTCCAGCATTATACGAATTGGTAAATCTCTGATCATCCCTAGGTAAGTTGGCATAAGTATTTTGATATCTTTGTTGAGGCATTGATTGATTAGAAGAAGTTGTTGAAATTCGTCCACTGTTAGCATATGTATGAGAATCTGACGAAACATTGCTTGCATTTGAATATAAAGCTGAATTGGTTGAAAGTCCTGAAGAGTATAAAGGCTCAGAACAATGTTTCAAAGGATAAGACTGTGGAACCTGAGGTTGAGGTTTTTTAGGTTTTGGAGGAACAG
>TRINITY_DN93_c0_g1
CAAAAATGTCATAACCTAACACAAAACGTTTCTTCTGTCAAAAATCAATGATTTATTGTGACTGGCTTCTGATTGGTCAGGAATACAAATTAGACTATCCTACTGTCATCCAGTAGTGAGGGAACTGAGAGGCAGGGGTAGTTATTTTTGCGGGAATGATATCCGAAATATTCACTATTTTTTTCTTAAACATAACTGAAATATAATTTCCAATGGAAAAATTGAAGGTTTGAGGTCTTGAGGATTTTTTTCCAATGGTGCAAATCCTAAAGAATTATTTACAAGTTGGCAGAATGTATTGATCTACAATTTCAAAAGTGTGAATCGGTACCGCCTATTCTGAGAAAATAAATATTTTCATTTTGTCTAACATTCTTAATCATTTCATAAACATGAGTGAAGTCTTAAATGCACCACCTGCGGAAACGATTGAGTCTCTTGCTAAGGAGGCAGAAGTTTTGAAGAAAAAATTAGAGGATGAAAGAATGAAACTGAATGATATTACATTGGCCACAGTTGCTGAAAGATTAGATATCATAAATTACATGAACATTAAGCCAAGAAGGACTCTGAAAGGGCATCAGGCTAAAGTATTATGTTCTGATTGGTCCCCAGACAAAAGACATATTGTCTCTTCCTCTCAGAGGTCTTGACAACAAAGTTACTGATGGTAAGATGATCATCTGGGATGCTTTTACAACTAATAAAGAACACGCAATCACTATGCCTACCACATGGGTGATGGCTTGTGCTTTTGCTCCATCTGGAAATTTAGTAGCATGCGGAGGTCTTGACAACAAAGTTACTGTTTACCCTCTGAGTATGGTTGATGATGTAAATCAGAGGAGAAAAAATGTTGGTACTCATACTAGCTATATGAGCTGCTGCCTATTCCCAAATTCTGATCAACAGATCCTAACAGGTAGCGGAGATTCCACCTGTGCTTTATGGGATGTGGAATCAGGACAGTTGCTGCAGAATTTTCATGGACATTCAGCTGATGTTATGTCCATTGATTTAGCACCCTCTGAAACTGGAAATACCTTTGTATCTGGGAGCTGTGACAAAATGGTTTTGATATGGGATATGAGGTCAGGACAGTGTGTTCAGTCATTCGAAGGACATGAGTCTGATGTGAACAGTGTCAAATTTCATCCAAGTGGTGATGCAGTAGCTACAGGAAGTGATGACGCTACATGTCGATTGTTTGATCTCAGAGCGTACATGTCTATTTTCTTTCATACATTACGATTCAATACTACTAGATGCATTTCGGAGATATTCTTAGAGTTCTTTGTATACATTACGATTCAATATAGTTAGTCCTTGCTTCTAGATGCATTTCGGAGAGTTTTTTTAAAACCCGAACAATCTGCATAAAAAATATTTTGTTATTTACTCAAAACTTTAGTTTAAATTGGGGCAATTTGTGAAATATTGTTGTCCATAATTAAGATTTCTTTTTTTGTTATTTATTGATGGTTACTCTTGGAAAATCTGAAACTGTTAGTAAAGTATCTTTCAATTTGATGATATTAGTTACAAATCTCTTTTGATAATACTTGTTTTGTTTCAGTGTCGATTGTTTGATCTCAGAGCAGATAAAGAAATTGCCATTTACAGTAAGGAGAGTATAATTTTTGGCGTCAACTCTGTTGATTTCTCAGTATCAGGGCGTTTATTGTTTGCTGGTTATAATGATTACACAGTAAATGTTTGGGATACTTTGAAGTGCGTAAGGGTTTGTCTCTTATATGGTCACGAGAATAGAGTATCCTGTCTACAAGTATCTCCAGATGGTACAGCTTTATCAACTGGATCCTGGGATTGCACCCTTAGAGTTTGGGCATAAACGTTAAGATAATATAACAAATCTATGTGAAATAAATGTACCAAAATAGTTGATATAGAAATGTCTTAGAGTATTTAGAGCCTTTGAATGGATAATATTTGTGAAATGTTTCCTGTTAAGACCTCTAATGTGGTGCAATATCATGCCAAACTTAATTCCACTGTTATCTATATTATTTTCATTAGTTTTTTTTTATATTTTATACCCTCAATAGTTTAGATACACATATTCATTTTTGTTATACAAAATGTAGTCTAGAATTTTATTTATTGATATGTTTATTGTTATAATATTTTTACTTGAAATAAATCGATG
>TRINITY_DN136_c0_g1
TTTACTCACTACAAAAAAATTTTTCACCTATTTAAAATATAAAACTCCTCATAGCTTAGAATCGGGATTAGTATATAAGATACCTTGCGCTGACTGTAACAAGTGTTATATTGGCCAAAAAAAATCTATTTACGAGATAGAATGAAACAACATAAATATGATAGTAAGAGTGTTATAAATTTTAATAAAACAGCTTTGACTACTTGTAAATCTCGACTAACAATTTATAATTTAAAACAGAAAGGTTATCG
>TRINITY_DN9_c0_g1
GGATGGCGTATTTCCGTTGAATAATTGATCGGACGTAATGTTTTCGATGCTAAAATGCTGCTTTTGTGAGCTGAGGCAATTTGAATTATACATCGATACACGGCCAGCTGTCAAACGTCTGGATTCAGGTGTATTATAGGTACAAGGGATGGCGCTCTGCGGCTATGGCTGCGACGAGGAATGGACGTCGAAGGTTTTGACATATGACCCCTAAGGGGTTATGGAAATGGGGGATGAAGGTGGAAATTTAGTCGGATATGGAGTGGAACA
>TRINITY_DN105_c0_g1
AATCCCGTCCGTTTCGTCTTCAAATGGCCACCCTGTATGCATAATCTAAATGTATTTCCTAAAATGATTTCCAACACTATGCTTATCAAAATAAAACAAAAACGAAGATGGAAGGTACAAAACAAGGGGGACGCCGACAAAGCGGCGGTAATTACCCCCAGTCCGCCCAATTTCTACGCCCTTGGCTGAATATTTCCGTTTTTCCGGAAAACGCCAAGGCGCCATTACCTCCCCATTTCTACGCCCTTGGCCGAATATTTCTGTTTTTCCGGAAAACGCCAAGGCAGTTTGGTAGGGACATCTTGTGGGTGTAGGATAATCCTTTTAAGTAGGGTGGCAACCCCTTAACCTTAAATGGCAATAAGGGTCGAGTGACAGATGACTTTGAAGTAACATCTTGTGGGTGTAGGACAATACCTTTAAGTAGGGTGGCAACCCCTTCATTACCTTAAATGGCAATAAGGGCCGAGTGACAGATGACTTTGAAGTATCCAGAGTAATTCAAGAATTGGAATGTTGAAATTATTCATAATTTGATACATTAATCAGCACACAAGTGTGATTAAAGGATCAACAATAACAACTTACCAATAGTATGAAGTGTTTTTATTAATGTTACAGGATCCACTAGGAGGGATCCACTATTAATTACTGTTCAGAAATGAATGTTAGGCAATTTGAAAATCTCATGCTTTCCAACCATTACTTCTAACTAGTTCTTTTTTATACCGAAACTGATTTTTCTTAAATATGCATAAATAGAAATAACCTTCAAAATTATGTGACACTCGACCCATATGGCTATTCGAGTTTCTTGACGGGATAGTCAAACCGCCTAAAGGGGAATTTTTTCATTTTTGGTCAGCCACCATAACCTACTTTATCTACTTCACAATTCTATTACCACCTCTATCCTCCAGTACAAAAAGCTCTAGATACTTCACTGCTACCTTGTCGTCAATCAGAAATATCGAGTTCTAAGATACATATAGTTGACAACACAAATTCTTCTTCTATTTATTAACCTGACTAGCTGGACTTCTTATTTTAAATGTGAGGCGCATACAAGTACACTATTTTCAACATTTTTTCAACCTCTATTCTACTATACAGGTTGTCTGGTAACCTGTGGATCAATGCTCAGATGGAGACAGCTGTGTGATATGGGAAATGACAATTGGAACACCCTCAAGACTCTCATTTTCGAAGTTCAGGATAATTTCCAATGGAGGCTTCAGTAGCTTTTTGTTTGAATGATATGGGAAATGACAATTGGAGCACCCTCAAAACTCTCATTTTCGAAGTTCAGGGAGAAATTCCCAATGAGGGCTTCAGTAGCTTTTTGTTTGATTAAATTAAAAAAAAAATTCTTTCTGAAAATCCAGGTTCGCAATCAGGACGAATTAAAAAAAAAATTCTTTCTTAAAATCCAGGTTCGCAATCAGGATTTTTTTCAAGAAAAAACAAATAAAGGAATTATGGTGCATCTCCTCATGTTTTAAAAGAAAAAACAAATAAAGGAATCATGGTGCATCTCCTCATGTTTTAGTACGACAAAAAAAAAGCGCCTACCCTAATAAATGGTTCAGGAGCCAATCAACAACTTATTTCAAGTGAAGCTATACAGAAAAAGCCTTATGTAATATGCAAATAGTTCTGAATGTGGAATGTGTATATTTAAGCTGAAGGGCGCCTACCCTAAAAATGGTTCAGGAGCCAATCAATAACAAAGAACAACTTATTCCAAGTGAAGCTAAACAGAATAAGCGTTATGTAATACGCAAATAGTTCTGAATGTGAAATGTGTATATTTAAGCTGAAGGTCAACATTTTGAGCGTATTTTGATTGAATTTTATTCCGATTGACTTTAAAAATGTATTATATTCAGCCTTTTTTTGCATAATTTCATCAAAGTTTAAAAATGTATTATTCAGCCTTTTTTTTTTGCATAATTTCATCAAAAACCCTTCTCAATCGTTCTGTGTCAGATTTTGATTTAAATATTTTGTTTCGGATAATAATGTGTTCTCATTGTATTCCTCGATACATTTGAAATGCTGATTACAGGCAAATAATTTCAGGTATTAATGTGTTCTCACAGTATTCCTCGACAAATTTGATTACAGGCAAATAATTTCAGCAAAAACTATTTTTCTCAAACTCGAATTTTGAATTAAGCCCTCACATCACTTTTGTATTAAAATTCTTCAATAGTATTTTTCTCAAAATCTAATTTTGAATTAAGCCCTCACTTCAAATTTGTATTAAAATTCTTCAATAGTGAATCTATTCCATTCCAACATCATTTACAATTAGAAATAAACAGACATTATTATTAAATATAAGCAAGCTCATAGAACATCGCGCGATCTATCCCATTCCAACATCATTTACAATTCGAAATAAATACACATTATTATTAAATATTAGCAAGCTCATAGAACATCGCGCAAAAAATAATTTACTGGCCACCATTAATTTACTGGCCACCATGTATCATGTAATATTAAAATGCAAACTTGTACCATCCGATAAAATTGAAAATGCTAACTTGTACCATCCGATAAAATTGGACCTGAACCATTTTTTTCTGTTTTGTTTTTACAAAAATTGAATTTTATAAAATGGACCTGGAATTTCTAAAAGAATTGTAGGATTACTAAATTCGACTATCTGTTTAGGAAGTGAAAATTCAGTATATCCGTCGAAAACAAGAATCCCAACTCGCACAGATGTTCTCTATCTCTACACCCTGTATATTAAGTTAACTTTTCAAACTCGCACAGATGTCCTCTATCTCTACACCCTGTATATCAACTCGCACAGATGTTCTCTATCTCTACACCCTGTATATATTATATACACGCCGTTTTCTAATTGAATGCATGCCAACATTTAAAAAGATTAAGATTCTATATGCATAATTTGAATTTATTTCCTGAAATGCTTTCCAACACTATGCTTTACCAAAATAAAACAAAAACGAAGATTTTTTTTACTAAAATGCATAGATCAATCTCCTTAAAGTTTACTAAAATGATGCATAGATCAATCTCCTTAAATCTTGACATTCAATCCGATAACCCGCATATAAAAACATAAATTTCTTCAAGAAGTCAACTCTTCCAGTAGTTCTTCAGTAGAACGCTGTTCCGTTTTGAACTTTTCCATATATCTCTTCGGAACAGTCCAATCTAGCAAAATTTGGACGTTGACTTTCAATTGTTCAGCAGGGGTGAGACTAGAATCCAAGCAAGGATCCCTTCCAGAGAATCTGATAGAATCGAGCAACACGTCATCAATCAACCTTTTATTGAAACCTAATTCAGTGAGACGTTCCGGCGAAGAAATTTTCTTCAATAATATGGCAAGAAGAAATCTCATTTTTCCTATGGGCATAGCTGCTCCGATTTTTGGTACTTCAACTCCTTTATTAGCATCTAGATCCGGTTGCTGCTCTTCAGAAGTACAACTTTTGGCGAACTTCAGAAGTACAACTTTTGGCGTGTGTCTCTAGCTCTTTCTTAGTCTTATGGAAGCTCTTGCAGCTTCCTTTATGGAAGCTCTTGCAGCTTCCGCAAACATACGGCTTACTGGATTTGTGAACGCAAAGCATATGCTTCTTCAAGTGAGGTAACTGTGAAAATGAATTGCTGCACAGGATACATTCGAATGGCTTCTCTCCGGTATGGCAACGGCAGTGGAGTTTGAGCGCTGTAGAATGTGCGAATGCTTTCCAGCAAACTTGGCATCTATACGGCTTCTCCCCTGAGTGGACTCTTTGGTGTACTGTAAGCTGAGATCGCTGGGCGAACCTTGCACCGCAATGGGCGCAACCGTGGGGTTTATCTTTGGCATGTGTTCGCATGTGTTGAGGCAAGTGGCCTTTCAATTGCTTTTTGCATATTTTACAATAGTAGGCCTTTACGTTAGCGTGGTAACAGTTCAAGTGCTTCCTCAGGGCATCTCTCCGGAAAAACAGTTTCCCACACAAATGGCAAATGTAGTCCCTGATTTCCAGATGTCGTTTCATGTGTGATCGAAGATTTGCTGATGTGGTGAATGATGTATCGCATACCCTACAAGTAAAAGGCTTACTGCCGTCGTGTGTTCGTTGGTGCTGCACCAATTGGCC
>TRINITY_DN114_c7_g1
AAAAGGTTTTGTGTAGATCGGCGTCTGTTATGTTTGGGTTTTCCTTCTGAATATTCCTCAAAACTTCGTATTCGTTCACGTCTTTCAATTTGAGACGGTAATCTTTGTGCATTTGCGCATCTTTATACTTCGTCTGGAATATCTTCCACTGATATTTCATGGTATATTCGCTTTTGTTGAACAATTTCATCGATATGCATCTTTGGAGATTCAGGAAGGTATTTTCGAACTATGCATCTTTGAAGATTCAGGAAGGTATTTTCGAAATAGAGGATTGTTTTGTCGAGGTATACTTCGCAGTTCCTCACTGCACAAATTAGTGTTGAGTACAACTCTACTCCCTCGAAACTGATAACTAGAATTGTTTTGTCGAGGTAAACTTCGCAGTTCCTTACTGCACAAATTAGTGTCGAGTACAACTCCACTCCCTCGAAACTGATAACTAGATCGGATGAGTTTTTCTCTACTTTGTAACTCTTGTAACTAACCTTTACGTCTAATACTTCATTTGGTTCCATAATACCAGTTCTTGGACAAACACTAAAGGGTTCAGTCACATTGAGCTTGAAGATACCGGTTCTTGGACAAACACTAAAAGGTTCAGTCACATTGAGCTTGAATACCACTGGACTTTTTCCCATATTCCTCATGAATACTTTTTTATCAGATGAAATGTTGTTCCTCATGAAAACTTTTTTATCAGATGAAATGTTTACCACAGTTTCCGGCATCTCAATGACATCGGGAAAAATTAAAATCGACCGAGGTGCCAGAGCTACAATTGGCAGATACACCACATCGTCTTCTGCTTCGAACCTAACTGAAGAAGAATAATCCCTGTATTCTTCTGAGTAGAAATCCAAAGTCATTTTATGAGGAGTACCAGGGGCAAGTTTCGAATAAACCGTTTTGGGCAATTCTTTCAAACGAAAACATGGACTCAGATCGAAAAATACCTTAATTCTAACTGGATGCTGTTTCTGATGCATGAAAGATATTATTGTCGAATACTTCACGTGGGTTTCAAAATTTTGAAACACTACAATATCAGGTATCGTCCACAATTCGTTCTGTCTTCCTATTCTTTGTTTTCTACTTCTGTCGTTCAAGATTCTTAAGCGTTCTTCACAGGGCATCCCTACTTCTTTCATGTATCTTGAGGGGGTAATCTTAACGACCTCTTCAAATTGCATGAAAGATTTCAGGAGGTCAGTTATTTGTATTTTATTATCATTTATTCTTATTACGTGCGACATTTTACTAACAAAATTAACGATATCAAAAATTATATTGAGAGATTTGACAGTTTCATCGTTCAATGACAG
>TRINITY_DN13_c0_g1
GGTGAGTATGGGTTGGGAGGGAGCTTTGCTTGAGCTTTGGTGGAATGTATTTGGAATAATTAATTTGGGAATCAGCAGAGGACCAGTCTACTGAATGTATGAATTATGGATTATTATTTAATGTTAGTATTGGTTTTTGTAGACCTTCATGCCCTTAATAAGAAAAACTGAACAGAGGACTCTAGTTAACACAGGTACCCAAATTATAGTAGGGTGTTCAAAGTAGACACATAT
>TRINITY_DN102_c0_g1
CAAATACACAATAGGACAGAGACTGATTATCTATTGGAAGATGATTTCGTGCATAACATGACATATTCTTTCTTCGTTACGGCTTCCAATAGATTCCATAAAAGTAAACAATCTGAAATAGTCACCTTTACTTTTGACAGGAACATCAATTTAAATGGCATTGAAAATTTAGTGGCTCTGGACGTGACAAACTGCAGCGTAACTTTGGCTTGGAATTATACAGGAGTGCAACCGGAAGGTTTTCATATTGATGTATTCATAAACGATCATGCTTATCCCCTATCAGAACCTCGAACCACTAAAGATTATAAAATTACCATTAATAACCTGTCACCTGGAGTCAACTATCAGTTCAAAATTTACGCATACAAAAAGCATTTAAATGACATAATAAATGTCAAAAATAATGCACAGTGTTACATTTTAAATTGTATGATTCCTAATGGAAAATCTTATACTCAATTGAAAGAAAATTCCTCATTTTACTACGCACTTAACATCTTCAACATCCACTTGTATCATTTTCAGATTTACGCATACAAAAAGCATTTCATCGGTCCTACTATAATTATTGGACAGCATACTAAAGGTAAACCACTTCCGGAAGTGGGTAATATTATAGGATCTATCAATTCTACCGAGGTTAACCTCACCTGGGAAAAGGTTCATGATGACAGAAACGCTGATTGGATTTATGGAGTGTACTATGGAATAGATGCTACAGATTTATTCAACAAACCTAAAATAGAAACTTCGAATCTTTCTGCAATCATTTCCCAATTGGCAGCGTGCGAAACTTATACTTTCACTGTTGGAGTTGTTGGTCCCCTCGGTTACGGGCCACTTTCCCATAATTGGGTGGAATTTACCACATCTCCTGATCTCAAGGCACCACCGAAAAAATTAACAGTGGTTAAAGATAATGGTAATCCACTCAGGATGAAACTGCAATGGGAACCTTCTTGTCGAACTCCAGAAAGCGTTAGATATGTTATAAAAGTGCACCAGGAAGTGACGAATGAAACTTCATTATTCAAGCTGAAAAAACATGACGGCAATTCAAATATGCAGCACATTTTTGACGTATCCTATGGAGGTATCTACAATGTGAGCGTGGCAACTGATGAAAAAGATGCAAGATTCACTCCTAGCGTGGATTACGTTGCACCTCCAATATTACCGCCGTATGAGGTTAGAGTTCTTGTGGAGAATAATGGTAGTTATGTACTGTATTGGCAGGAAAGAGAAGTTCCACAACTTGTTGGGCAGTACATTTACGAAGTGATGGTGTCGGAAGGTGACACCTTACACGAGAATTCTTCAGAGAAGTTCCTTGTCGACAAACCACCATTTATTTACACTAACTTCACAAGTAACATGTACACGTTCGGAGTTAGATTGAAGAGTCATGAGAACTTCAGCTCAATTATATCCGAAAGAGTATCGATGTCCAACGATTTGAGTAAATCTGTAACATTGACCAGAAGTAGCGTGAGTACAGTGATAATATGCGTCGTCACTCTATTCGTTTTACTTTCTGTCACTATCGGCGTGTTGTTTGTGAGACACCGAAGGCTCCAAAAGAGCTTCTCGCGTTTCACAAACTCGCATTACGATACAAGATCTGATGCCGCAACTTTCGATGATAATAACGGTTTAGAGGATGACATACCAAGAATTCAAGGTTTCTCGGACGATGAGCCTCTGGTCATTGCTTAAACAAGAATTGTATCCTATTCAAAAATTCGAAATAAAACTATTTTAAAAATAAAAATAATAACCTATCATATTGAGTGTGTTAGGAAGGTTGGGTTTGTTATGGATGCATTGTTTTTGTTTATTGATTTAGTGCTTGTCTGTAGTATCTTCTAGTCTTGGTTTTGTATTTTTTAAATGAAATTATTTGAATAATTTGTAATAAAGAATGATTTTCACCGATTGAAATTGCTAATATGAATTTTTTTAATCCTGATATTAAAATTATCGAATTCAACAATGAATAACTGTATTCTTCCATTTCAAATTAAACTTCGTTGTTTTTTTTATGATTTGAAACTTATGACGCTAGTTGCTTTCAGAATTTCTTCGTCGAATTGTTGTGATTATAGTATGTTGAAACATGCTGATTTCCGAAGGAATTCTGTTGGTAATCGAAAGCTACACTTTGAGTGTTGTGTCAACCTATTTTTATATTGTGATATATCTGTGTCAAAAATCTTTTCTCAAGCTGCTCAAAGTGGAACATTCCGTTCTATAATTTATTTCAATGTTTGGTTGTACGAATGAAAAAACCTTATTCTTTCTATATTACTATTAATTGATGTTTCAATGGTATAAATCCTAATAAATATTAGAGTTATTGCACAACGCAAGGTATTAATTCCAAAGAAATCTTTCAAGTCGATTGGAAATTCGAAACTTTCATATTGCTTGTGTCCAGAATTAGTGGTAAATAGAGATTCATATACATTTTTACAAAAGCTTGCGATATGTCAAAGAGTCGAATTTTCTACAATCGATAGCAGTGTTGTTTGTGAATTTCTCAGTTCTGTGAAATTTTAGTATTTAGATTTTTTTTAATATATAGGTCAAATTCTGTGATACTTTAATTTTAAGTTTATTTTGATATAAGTGGAAGAATTTGACTTTATCTTAACCTTTATAAAATGTTGGATGTTCAATAAAATATTGGAAAAG
>TRINITY_DN69_c0_g1
ACCGTCGATACGTACTAACGTGTATATAATTCTAGCATTTACGAGATGGATCAAGTCAAGGAAGTCCTCAAACGAGCTGACGCTGTTTGTTTTGATGTAGACTCAACAGTTATTCAAGAAGAGGGTATAGACGAGCTTTCCAAATTTTGAAGACGAGCAGACGCTGTTTGTTTTGATGTTGACTCAACAGTGATTCAAGAAGAGGGAATAGACGAGCTTTCCAAATTTTGCGGAAAAGGCAAGGAGATATCAGAACTCACGGCCAAGGCTATGGGAGGTTCAATGACCTTCCAGGAGTCGCTCTCGCTTCGCCTGAACATCCTTCAACCGTCCATAGATAAAATTAAGGACTTTCTGAACATTCTCCAACCTTCCATAGATAAAATTAAGGACTTCTTGCAGAAAAAGCCAGCCAAACTATCACCAGGTATCAAAGAACTAGTACAAACGCTTAGGAGCAGGAAAGTAGAGGTCTACTTGGTTTCGGGAGGATTCAGATGTCTAATCTCTCCAATTGCTAAGCAACTAGACATTCCGAGGAAAGTAGAGGTCTACTTAGTTTCTGGTGGATTCAGATGTCTAATCTCTCCGATTGCTAAGCAACTAGACATTCCAGAATCCAATGTGTACTGCAACAAGCTGAAATTTTTCTTTGATGGACAGTTTGCTGGGTTCGACGAGACACAGCCTACATCCCGTAGTGGGGGTAAAGCTGAGGTAGTAAGAATTCTGAAGGAGAAATTCGGGTACCAGAATTTGGTCATGGTGGGTGATGGTGCTACCGATCTGGAAGCTTCTCCTCCAGCTGATGCTTTCATTGGTTATGGTGGCAACGTTGTCAGGGAGAGTGTGAAAAAGAATGCCAAATGGTTTGTGACGGATTTCCAGGAAGTTATTCAAGTTTTGAATTGATTTCATTGACTATAGTTCTCTTCATATTGTTAAGTTTTTTATTTTGCATAGTTCCCTTTATATTGTTAAGTTTTTTATTTTGAGTTTTATCTTCATTCGTTATACATTCACTGATTACTGTTTTTTCTATTCGTTATTCATTCACTGATTACTGTTTTTTCATATTTATTTTTGTTATAAAATGTATCATTGTTTATAATTGTATATTTGGGGATGAAAATCTGGAAAACCTCTTTGTATCCCAT
>TRINITY_DN178_c0_g1
TGGAATTCCAAGGAGGAGATCCACTCACTTTTGCAGTCTATACAAAGTCGTCGTTGTTGGTTTTTCATCAGTCTAAAGGTAGAAAGGTGGAGTCAATGAAGAATAGAAGGTCTTTCTGTTGTTATTCATTTTGTGGTTCTTTTTTGTTTGTTTGAATGTCATCTTCGTGATCTGCGTCAGCAGTCCCACTATCACCTGAAGCTCAGCTCGTGACAGCTTCAAGAGCTTTCTGG
>TRINITY_DN172_c0_g1
ATTTTGTTACCCATGACGATCATTTTGTAGTCGATAATTGTTCATTGATTTTGAAAGGGCCTGATTAAAACCGAATTACATCAGACTCGTTTATAAGAGCATGGTATGCACAAAATTTGCAGAGCTAGCCCACTCCATGCTTACATTGATAACATTATGTAATCCTTCTTCCTGATTTAAATTGTTTGATTTATTTGCAGTTATGAAGATTCTCTCCAGTCAGTGTCAG
>TRINITY_DN149_c0_g1
AACAATTCTACACTTTTCAAAATCACTAACATTATCCCCAAGTTGACAACAGTAGAATTGACGTCTTTGAACTCCAGTCATTTTGCTGAGCTTAACTATAGCTTAATAAAAGTTGACGATCGGTCAATACCTGAAAATAACTGTAGTATTCAGGTTCCATAAACCGCTTTCTTCACAATCAAAATGACAAAAAAAAACCTTGTTTATGCGTCGATA
>TRINITY_DN150_c0_g1
AATTTTCTCAGCGTTTTTTCCTATCATTCAATATATCAATATTTCCTACTGGGTAAATTGTAGAACAAAAATGAATGATATCAGTTCACCAACTTACTATCCATTTTTTTAAATTTAATTGCTGCATAATTGTTAACAAAAATATAACATATTAATTGAAGTTGGCTTTGTTATCATTACTGTTCGTTGAACTTATCGAACCTATTTACTAAAATATTTTCAAACCTATTTTATTATATACTAGTGGAATAGATTGGGGGATCAAAATTAAATTCGAGATTTTTA
>TRINITY_DN91_c0_g2
AAAATAATTACTATAAGGCAATAATTATTTGTTTTCATTTCTTCTAGTATAAATATAAATTATTTGTAATATTGACCTTTTAGGTGTGACGTTTTGCAATCTTCCAGTACTAATCTTTGCTTTATCTTTGAGTTTGAAGAAAGAATGAAATGAAAAGAAGTTGAAGTACTGATTTGTTGTTGACCTATGACTAATTTATTCAACTTCATTTTGACATTCATTAACCAAAATTTCATTATTAGATAGAGTGGATAACACATTCATTCAGAAACTATAGGTTTTCAGGCCAGAAAAATAGTTTTGCTTGAGTGAATCGAAAAAACCAGAATATATTTGAGATGGTAAAAATTTTTTATTATCCCAATAAGATTTACTCACAATCATTATAAAAATGAAGAAACAAAGAAAATAATACATGATATCATTTCTGATCAATATTTAAAGATATTTAATACTATTTTACAACTTAATTTTATTCATTCAAGACAAGAAAATCCGTTTTATTCATTATCCTAATCTTAACAAATTGTGCCACAAAATGCTTAGGAACCTGTAAGTTTTTCTAAGCAAATGAAATCAAAGAGCAAATCTTAGTTCAACCATATTGATCAAAATGAATGAAAGGAATGCCGAGAAATAATAGTCAGTGATCTTAAATTGGAAATTTTTCAATGCTTGACAACCAGCGAGGATAACAATGTAAGAACAAAGAAGATGACCAACAACAGAAATATGTACAAATAAAATATTCCTCATAATATAAAAAACATATGCATGCATAAGTAGGCACTCGTCTTCAAAAATTCTTTGATCGTGTTAATTTTTTCAAAGTTAAATATAGAGAACTTCAAATAATTTTATTTGTACATACAAATTCAGTTTTAAGTTGATGGATAAATATTTTTTTCTGTAAGTCATGATTGAATGTTAGGCAGCCAAGTAAAAAAAAAAATTTGAACTACTTTTTGTAGATTATCAATAACTTCAATATTGAAATATATACGCCCTCTCTAACCGTCTCAATTTAATTGTGAAATTGAGGTTATGTTCAATTTCATTTGAAATCACAGAATTACAAAAAAAAAAAAATAAATATAAACTGAACATAAAATAGGATTCAATAATGACAATCTGTCAGTGGATTAGGTCGATTTTCATCAAAGATGTTCCATGATTGATCATCTCAATTATTCCTATTGTTACCTCGCATACCATTGCGGTTCGGCCGTGGTCGGTTGTTAAAGTTGCCATTGTTATTGTTCTGCTGTTGATAATAGTTATTCCTTGGTGGTCTGTTACCTGGACCTGTCATATTTGGTAATTGTTTCATTGAGTCAACAGTTGAATTATTCATATTGGGGTCGTCGATGCCATTCTTTGAAATTGTTGTTGGCTGCTGTTGCAGCTGTGGTGGCATGTTGCCAATCGCGTCGGCTGCTGTTGCAACTGTGGTGGCATGTTGCCAATCGTTTGAAAATGTGATGGCAATGGAATAGGTGGAGGTGGTTGATTTGTTGTTGACCTATGACTAATAATGAATCATTATTATTTGAATATTTAAACAATTACCCATCTGTCGTTTTAAATCTAGGTGTGACGTTTTGCAATCTTATTCGACTGCTCAAATTTTTACATAATAAAGAATCATGAATGATCTGGATAAACAGTTGGCAGAATTGGCCTTATTGAACAAGAAAGAACTTACACCAGGATCTAATTCTGGAACTTTGGGCAGAAAAGTCGGTCCGGCTGTTCCTCCAAAACCTAAAAAACCCATAATTCTGATTTGTGTAGGTTTGACTTGGAATCTGTTCTAGTGGTGTATTGTCAATTTCAGAATCCTGTAGGAAAAAAAAAGTTCCAGTATTCAACATTTCTGCTATAGGCCTTTGTAGAGCAATCTGAGGCTGATTGAGCTGTTGTTGTGGCTGTTGCTGCTGTTGATAGAATATTTGTTCTGGGGGAATATTCTGGGGATCCATATTCAAGGAATCATGGGGTAGTTGAGAAGTTACAGGCATGAGATTTTCAGGGACCTGTTCCTGTAAATTGTGTTGTTCAGGCTCCACAATTAGATCCTGCTCTTCTTGTACAACATAAACACTTTCTTCTCCTTCAATCACACTGGGTTCTACAAAATCCGAACCCTGATCAAAATAGCCACTCTCATGGATTTTCCCCAGAATTTCTTTAACTTGACTATATGTTCCACCAAAAATTTCTTTAGGTTTACCATCAACAACAGCTAATAAATGCTCGGCAGCTGCTTGAACTTCATTGGTGAATGCTGTAGGGTTTCCACTTTCATGCTTTGGTATAACAGCAGGATATATTTCATCTAGCAATTTCAGATCACTTTCATTCAAATGGGCAGCTCCATTTCTCCCATGAAGAAAATCGTCTCTAACAGACTCATTTCCCATTTGATTTAAAGCATCCTGTACTAAAAGAATTTCCCGTAGTCTTGCTAATTCGGCCTGACTTTTTTGTTGGGCTTCTTTTTTAGCCTGCTTCTTAGCATCTTTTTCAGAGTTACTGGCAATGCCAAGAAATTGCTTGCATAGATCTCTGGCAAATTCCAAAGTCTGAGCCACTTCATCATATTTAGCAACAGCAACCTTCTGATCTGTATTCAATTCCTTACCAGCATTTTGTAAATCGCGATAAGATTCCAATTTCGACTTCCTCTTTTCCAGATTTCTGATTTTGTGTTCTATGATGGTTATAGCTTGTCTTAAAGGTGTTAAAGAACCCGAATTTTCTGGAGCACCATTTCCATCAGGGCTAGAATGCTTGTCATTTTTGACGTTTGCCGCTGAAGGCATTTTTCCGGATATTTATATTCTTTTATTAAACAATAATAATAATATTTCTATGTTGATCTCTTAAAATCAGTTGCACGTTGAGCTCTGCAAAAATGAGTTCACCAAAACTCAAAGCTCTGTTGACGACACAAAAGAACTCTCCATTGAGAAGACGACCGACTGACTTGTATGAAATTTCAGGAAACAGATATGATTGGCGTAAAAACAAACCGGAAGAAGGCATACGACGGCGGGAAATTTGAATCAAGAGAATAGTGACTGATTCAAATGGGCAACCGAAAACTGGAGATGCAAAAAATTGAATAGTGCAGATAATATTCCTTTTCGTAAAATTATTATGTTTATTAGGGATACAATTGCAAGAATAAATTTTTAAAAATCCGAA
>TRINITY_DN118_c0_g1
TCACCTCTCCTATAATTGTCCAATATAGCCAATATCCTACTAATACTAATTATAAAATATGAAAAGTTCAATCTTCAACCGTTAATAATTGTAGAAATGCACTTCATCAAAACTTTGACCCTACGCATGAAATTACTGTTTCCGCCCATAGGAGGCTTGGACATGAACTTGGATCGAGTAGATGGAGATCGACCAACCTCTTTGGAAAAAATAGAAGAAGACTTTTTAAGCACCAGAGTTCAACTTGACGGCTTGACGTTG
>TRINITY_DN40_c0_g1
TGCCCACGAATCCCGCTGCGACTTGAGAGGGGGCAAGCACACTGCTTGAATAGAGCCTGAAGATGTTGCTACACGGCTAATGGATTATGGTTTTTTTTTAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCATTTTCTTCCTCAATCCAAAAAGATCATTCAGGAGAAATGGCCACCGTCACCACTCAAGCTTCTGCCGCCGTTTTCCGGCCATGTGCCGCCCGATCAAGATTTCTTTCCGGTTCTTCCGGTAAACTCCACCGTGTGCTCTCGGTTAAGCCAGTTTCTGCTTCTTCGTCTTCATCTTTCAAGGTTGAAGCTAAGAAAGGAGAATGGTTGCCTGGTCTCCCATCTCCGGCGTACTTAAACGGCAGTCTTCCCGGTGACAATGGATTTGACCCATTGGGATTAGCGGAAGACCCAGAGAATTTGAGGTGGTTTGTTCAAGCGGAGCTGGTGAATGGGCGGTGGGCGATGCTGGGTGTCGCAGGAATGCTTCTACCGGAAGTTTTCACGAAGATTGGAATCATCAACGCCCCTCAATGGTACGACGCCGGAAAGGCAGAGTACTTCGCCTCGTCGTCAACTCTGTTCGTGATCGAGTTTATCCTCTTCCATTACGTCGAAATCCGCAGATGGCAAGACATTAAAAACCCTGGCTGCGTTAACCAAGACCCCATTTTCAAGCAATACAGTTTGCCCCCAAATGAATGTGGTTACCCGGGTGGGATTTTCAATCCCCTGAATTTTGCCCCCACTCTTGAAGCCAAAGAGAAGGAATTAGCCAATGGGAGACTTGCGATGTTGGCGTTCTTGGGATTCATTGTGCAACACAATGTGACAGG
>TRINITY_DN104_c0_g1
ATTTCGTTAAGAAATTAGTCATTGCGAATTGGATCAGTTAAAGATTGTTGTATCAGACCATGAATTATTCGAATCCTAGTATAAACTTATCGGATGGAATAACTGAGTACATAACTACGAATGAAGATGAATCTGACAGCACCCAATATTTGTCTGTTTTGAGCCAAGACCTATCCTTACAAGAGATGAATGTAACTTTGACTACTGATAAAGTCGTGGAAAATAATGAAGAAACTAATCAACCTTTCATTTTTACTGTGGATGGTACTAATGAAATTTATGGTGTTCAAGTAGCTCAAGATGATGATGGTAATCTTCGAAAATATCAGATTCAATATAGTGAAAATATTAATGGAGACTTAGTACCTATGCTGGAAACCATTCAATTTTTACCCTTAGACGAAGAACAGGTGCTTTCATCAGAAGAAATTTGTGCATCTACTGAAGTTACCCAACTAAACGACAATTTTGTTGTGAAAAATGAGGAATTCATCACAAACTCACAAAATGATTTCAACATACATGATGTAACTGAACCACATATAAATAGAGATCAAGAAGAATGGAATATTCCAACAACAAATATAACTTCCTTTCATATGAAACATGAACCAACAACTTTATTTGACCAATGTTCTATACTTCAAAATGAAGAAGGGAAAACAATTACAATTGAAGCACAGAATACAATGCAATATGCTTCTGTTGATTCTGAGTCAACAGAAATTTCTGGAGATGTGGAAATGGATCATACTGAAAGCAGAATTATGTCTGTTCAACACCTAGATATACAGCACTGTTTAAAATATGAAGCACCTGAGGAAGCTATTGAACAAAAACATTTTCAACAATTGTACTCAGAAGAAAATCATATAACAGAGAGTAATCATCTTGTAGTTGATAATTCTATGGTTAAAGATAGTCAACAAGAAGATTTATATCATATTTTGGACAATAGTATTTCTAATTCAAAAAGTATCTGTGATCAAAGCATGCAAACCATCCTAAAAGAATCAATAGATCATCCTAAAACCAACATTTTGAAAAAATCTATTCAAAAGAGCTTACTTAAAGATTTTGCCAATTCCGACCATAATATTGTTTATGTTCAGACATTACCTGAAAAAGAAAATTTAACACTTGTTGACATTGAAAGCTTTACCAAGCCAAGCTCAAGAAGTTTATTGAAATGCAATCAACCACCTCAGGTACTAAAGCAATTCATGAATTTCATCAATTCAACCACTATTCCTCAGGCACCAGCTCAACCACCTCAGGTACTAAAGCAAACAGATACTCTTTATTCAGATGATAATTATAGTCGTCAGAATTTATGTTCCAAAGCTACTCCTCGTACCAAAGAGACAAAACAAATACAGGCATATTTGCGAACCAAAGAGGCTAAGCAGGCTAGGCAATTCATGAATTTCATCAATTCAACCACTATTCCTCAGGTACCAGAACGTAAAGAGAGGCTGCCTAGAAAACAGCAGATAAAACCTGTTAATCATCCTGATGAAAACATTGTTGTCAAGGAGATGATAGTATCCTCAAATGGCTTTGTTGAGCCGATTAGTGCTGAAGAAAAAAAATATCTTCCTGTTACAGAATATGTTGAACTTCTTGACTCAGGTGATGAAGGAAATTCTCTGTGCAATAATAAAAAAAAGAGAAAAAACAATAAAAATGATAAATTAATTGAAATTGAAATAAGCGATACTGATGAGTCTGATGCAGCAGAATTAGAACCTGGAAAATTAAGGAGCCTTCCTAAAGCAAAAAACGGATTGAAAAAAAAGCGAGGAAGACCCCCAAAAAATCAAACTTCTGTTGATGAGAAAAAACATCCCTATCCAAACTCACCTCCTAAAATGAGTCGTTTAGATAGTGATGTTGAAAGTGTCACATCTACCTTACAAGTTATCACAATGGAAAGTGAAATGAAAAATGAGTCAGAAAATGAGAAAAATACAGGATCTTTAAGAGAAATTTCAGAAAACTCCAGTGAGGTTAAAAGTTCAACAAAGAATAGAGAACCTCAGGAGGGAGATCTGATTATTACAGAACATTGTATGAGTAAAGAAAAATCATCACAAACCAATTTGAAAAGCAAAGTATCTCAGCTTTCTGGTGAATCGACTTGTAGGAAGACATTTGAATACAAATATGAATGTGAAAAGTGTAAATCTAAATTTATCAATAAGTTCGTGATGAGTAGGCATGATTGTATTTTGAAATTTGGATCTACCTTTTCTTGTGATATTTGTCAGCAGAAGTTTGCCAACATTGTCTCTTTAAATACACACAAAAAAAGTCATATCAAGGAACCCATATTAAAATCAAATCTGACAAAAATTTCCCAAGGGAAAATATTTCCAAAGAAAGAAGGTGTTTCTAGTAGCTCTTCTACTAAACCATTGATATCAAATTCTAGAACTTCGATTCTTTCTTCCAAAAATCCCAAGCAGGTTTCATTGTTGGTTAAAAATATTAAGCAAACTCTACCTCTACCTAGAAGCAAACAATTGGTAGTTCCTGCCACAACTTCAGTGCAATTACCAAGGCATTCAACATTGTCAGAAAAGAAATGTAATTCAGTTGATACATCAGAAAATGTTGAGTTGGGAAATAGTAGAAAGCCAATTGAGGAAGGTGTTTACAAACCTCCATTAATTGAAGTTACTCCTGGAAAAACTCCACGTAGTAATATTTTTAAGTGGGAAAAAAAATGTGATAAATGTTCGAAGAACTTCGATAACAATACTTCATGGTTTGATCACCAAGTTTTGAATCATGGCTTCAAAACACCTGATAAAACTATTGGCGAAAAAAGGCAGAAGAAAATCGTCAAGGATGTTACTGAACATAAAGGAATACGGGCAGGTTCTACTGTTGCCAAAAGTTTTTCCATGTTAAAAAATAAAGTGCAAAAAATTTAGTGCATGATGTGAATATTGTTGAATATTTTTAATCATATAATGAATATATATTTATTGATATAGATTTTTAATAATAATTACTTTTTCAGCATTATGAAGTCATTACTTATATCACAAAAGTGATAAAGTTGAAAGCAAATTAGCAATAAATTCATAATCTTACCAAAACCTTCGACTTATCGATTGAATGGAATTTTGTACCATATACAATATTATCTATATTTATAAACTGACAGATTCATCAAGAATGTAAAGCTTTATTGAAATTCATATTGAATGATCTTTATTACCACTCTATATTTGTGTGTATATATATAAATATATTTCATGAATTTCAAGATTTTTAATCATGAAGTCTCGTATTTTTAATATCTATCAAATTCCAATACTCACTCCTGAATAGAAAAAAATTTCTGAAGCACCAGCTCAACCACCTCAGGTACTAAAGC
>TRINITY_DN50_c0_g1
GAGATTTTTGTGCAATTATGGATTATGTCTAATATGAAATTTCGTTCTAGGTGTACGAGTTGGAGAGGAGGCTGAGTTCAAGTGGTTGCAGTATGAACGGAGGTTACCCTGTGATGGGGCAGTTTGGCGGAGGCCAGTACTGCCCTGTATCGGAAAATTTGGGGCTGGGCTCTCACTACTCCTCGGGATGGTACCAGACTTCTGCGGCCGATCCCAGATTTGCAATATCAAGATTGATGGGCACAACAGCTGCATCAGCAAACATGGGTCACGGCCTGAACGCAGGCATGCCGGGATTGGGCGCCTGCGCGGTGACGGATTCTAAACCCATGCAGTTCCCCCTTGCACAGAGGCGAAAGAGGCGTGTCCTCTTCACGCAGGCACAGGTGTACGAGTTGGAGAGGAGGTTCAAGCAACAAAAGTATCTATCGGCGCCCGAAAGGGAACATTTGGCGTCTTTGATACATCTCACTCCAACACAGGTGAAAATATGGTTCCAGAACCACAGGTACAAGTGCAAACGACAGGCCAAAGAAAAGGCGATGGCTGAACAAAACCAACACAACCAGTCATCCAGTTCCCCGAGAAGAGTAGCTGTTCCTGTACTGGTAAAAGACGGAAAACCATGCTCAGGTGGATCTGGCAGCAACCAGACATCCTCATCGTCAGTTGTCGACACTAGCAGAACACAGCAGTCCCCAGCATGTCAGAGCCAACAGCAGGCTCAGTGCATGGCGAATAGCAGCTTATCCATGGCCTACAGACAGCAAGGCAACTACCAGCAGCAGTGCGGTGGTACATATTTGCCGTTACAGACTAGAGCCTGGTAGTGACACGAGCAGTTTGGAATAGTTTACAGTAGTGATGATGTGTGACGAGTAGTGCTTTCTTTAGACGGACATTAGTCGGACATAATAGAGATGTGCATGAAGTTGGTTGACGATTGGAATTTTGATGAAGTTTGGACTGCTCGCTACTTCACACGTCAAAAAGAAGTATTCGAAGACCTCTGAAATTTTGCCATTGGTACTGGCACTGAATTATAACAGTTCTCTGCTTTTTGAAGATATAAATCAGAGGTTTCTTGAAAAATTTTCACTGGGAAAAGTGTAGAAAACACTCCCATTAGATCAACTCGACTGAAAAATGTTCAAATAAAAAAAGGAAATGTTATGAGTTCGGAAAAATCTGAGATTAATAGTGCAATGATTAGAAGATATGTTTTTTCTCATTGTAGTGAATTAATGATATGTAATATAATTTTCTTCCAGTGAATGTAGATTTTTATCGTTTTGTACAAATTTCTTGAGTGTATATAATATTTAGCGTCTTGGGTATTCGATCGCATATTTCAATATCGAAATCGATTTCAATTTCAAAGAATCTCTCACAATGTACATAATATTAGTATATAATGTTGCACAATATTATAACATGTGTGTTTATAAATAAAATCGAATAAAAACTCAATTCAAATTCAATAAGAATCTTGTTATTACTACCAACCTTCTTGATTTGATCAAAACTAGGTCTATAACCTGCCAGTATATCTAACGGCTATGTAA
>TRINITY_DN59_c0_g1
TTCTCATGAGGACGACATCAACACATCCTCTCAGGCGCAGGGAAATTCTAGTCAGCAAAACGGAAACAAGACTGCCAGCCCTATGGACTCCTCGGTGATTCATTATTATTATTATTTTTTTTTGTTATGTGTCGGTTTGCAAGGTTTATCTTATATGAGGCTTAACTCCCTATCAATTAACATAATGTGTGTTTACAGTATCAAGAGGTCATATGTTTCTCAATTGGCAGGATAAAAATTTCACTCTAAAATCAAATTACTACAGGACTATCTGCATCTCACAGGGCATTTTGATCGAACCATAAATACGAAAACAAAAAGGGGGGGGGGTATTTTAGATTCAGCATTTCAAAATGAAATAAAAGTTCATTATGGAGAAGATTCTTAAAAACACATTCATTATGTTTGATATTTATGCATAACAATTATACCTGTAAACTCCTATCTCATAGTAACAATAAATTCTTCATTTTAATTTTCCTTTGTTCAAGGATTCAATTCATTATTTTGATGTTGACTGCTTTGAAAAAGAAGACTTAGAAATGAAAAAAGGAATTACATTTTCTTAAAAATTAAACAAGATGGAGAAGATTCTTAAAAACACCCCTAAATCAATATTAGTATCGTATATAGTCGCCATAAATATGCGAACGGTTCCAATACACCTGAGATTGGCTTCTAATAAGGTGCTGAATCTGTTGGGAAGTTATAAATAATGCCCATATTTTTGTCCAATTTTTTAAGAACCTGAAGACATCTCTAGTTTTCAAATGTCCATATTTTTGTCCAATTTTTCAAGAACCTGAAGACATCTCTAGTATATCCCTGACAGATATAGGATTACAGATTTTTTTATGAGCAATTCGAAGAGAGCTATTGATAAGTTTCGAATCTAGTCTATAGAAATATTCCAATGTAGATTGATTTATCTAAAGGTATAAATTTACATTATGAGACGAAATTACACATTTACACAATACACATATTGTGTAAATGTGTAATACTGAAAATTATCCATTTCAATACCATCGTCAACAAGAAGTTTTTGAAAATCGACACCAATTATATATTTTGTTAATTGTCAAGGAAGGGTATCGCTTTGCTTTGAGGTGCATAAATATTCTTTTCTAAATATAAAATCTTAACCCTTTATAGTATTGTCGATGAATTTATAGTTTACTCATCATAAACAATCCTTTAGTTACTAATTGGTAATAATTGGTTATTTCAATTTATGTCCTACTAATTGCATGACGCTTGGAAGTGATTCAGTAGAGTTGAATAGTTAGGAGAATCCAAATCAAACTAACCAAATTGTAATGAAAACCTGTAATTTTTGAAGGAATTATAACTGAATCGAAAATTGATTCGATCGTTCACCCAGATAATGAAATTTTTCTATTAAGAATAACACAAGAATAGGAAAGTAAATTATTCTGCATTAACTATGATTCTACTGGATCCAGTAACTAACCCTAACAGTATATAAATGGTATCTCATATAAGTGTGGATCTTTTTCATGCCTCCTCATCTGCTTGCGGATGCATCTGTCTTGTTCCACGTGGAACCCAGTAGCCAGCCCTATGGACTCCTCGGTACCCTCGAAAACATCCCCACCCAGCCACTACCCTCCCATCACAATCTCCACCCCTCACACGCCACTGACCTCCCCTCCAGCATCGTCATATCCTGCTATCCTAGTCGGGCGACCGACTGCTGAGAACAAACCTAAAGTGCCACCTCCGGTGCCCCCTAGAGGAACCCCCAAAACTAAAAGAGGCGGAATTTCTGCAAAAGGTATAGCGCAAAGCTGCTGCAGCACGCCACCCCCAACCTTCGACGAGGTCCTGGAACAACGAGCTTCCGAACCTCACGAGTCTACGGGGGCGACTCCGGCCAGGAGATACCATCACCATCATGGTAGTCACGGCTCGCATTCCATTCACCAGAGTCATTATCATGCATCCGTCCGGACTTATAGAGAGGATGCAGTAAGCATTAATGACATAAAACTAGAGGCTCGTGCCTA
>TRINITY_DN159_c0_g1
GATACTTCTTTGGAAATGAAGGTGTCACTCAAGCCGACAATTCTCTTCGCTATAGCCAAATGATGTGGTACCAGCTAGATAGTGCAACAAGCCACACAAGATGACCCGTTTTGGCTTTATTGAAAAATATTCTGGGGACGCTTAATTTCTCGTTTTACCGAACAGAGGAGTTTATAAGAGAATTCGGATACAATTTCTAGAGCAACTACGAAGCCACACCACAACAAAAG
>TRINITY_DN147_c0_g1
GAAAAAGATTTGCAGCCACAAATAATTTTATTTCTGCGAGTTGAAGAAGAAACTACCACTTCTGGGTGTAACACTACAGCTGTCACCGATGACAATATGGCAATTGGGAAATAGTGTAAACAAATATGTAAACGTTGCAACAGTATCGACCTTATGTGTATCCAGGAATGGATTCTTGAATGTCGCGCTGTCTTGACAATCAACGATTTCCTTATTATTATTACAAGTTGGATTTCCCACGAATTGGATTTGGGCTTTTCCCGAATGGTGGGTAAATATTCAGTTCACTTGAAGTGATGCAATGAAAAGTGCAACATAAATAATTCATTGTGAGAACAACACTGCAAATTCATCACAAAGGATTTTTCTTCTTTCGCTATTGCATCTATTTACTTGGTGGAAAGTTTTTAGTTGTAATATGTTTAGCTATTTTTCTTTATTTGAAAATCGTTATTTATAATACAAGTGCAGAAGGCACTGATATTCCAGGAGTTCAAAAATCAAAAACAAGCCACGGAATGACGATTTTCTAAATGATGGAGGGTTAAAATGAGCCTTCTGTACGAGTATTATATATTATTTTCTCTAATCCACTGAATTTTT
>TRINITY_DN162_c0_g1
GTGATCTGAGTCTTTACCTTGAAGAAGACCAGCAGAAGATCACAGCCTCCCAATCTGCAAAAGAAGGAAGTGACAAGAAAGAGTATCCAGTTGATGTATCGCTGCCCGACATCAACAGTGGGATCTACGGTACCGATGATTTCAGGATGTATACTTTCAAAGTGAAGCCTTGTTCGAGGGCGTATTCACACGATTGGACCGAGTGCCCTTTCGTTCATCCCGGTGAGAACGCTAGGCGTAGAGACCCCAGGAAGTACCCGTATAGTTGCGTCCCGTGCCCTGAATTCCGGAAGGGGGCTTGCCCAAAGGGAGATTCCTGTGAGTATGCACATGGTGTTTTTGAGTCTTGGCTCCACCCTGCTCAATACCGAACCCGGCTCTGTAAGGATGAGACTGGCTGCACAAGGAAAGTCTGCTTCTTTGCTCACAAACCTGATGAGTTGCGCCCAGTATATGCATCAACAGGCTCAGGCATGCCTTCACCCCGATCTCTTTCGAGCAGCACTGGAGATATG
>TRINITY_DN114_c0_g1
TCCAGTGTGGGTGAGGGTTATCTGTTCTTCCAATGGTTCACAGAAGAGCTGATACCCGAAGGAAACACTCATCTTATCAATATCGTAGGCAATATCTCCACAGACAGCAGAGACCTCTATCTTCTCTTCAGCGCCACCCAGTATTCTGCATTTTGCGGTAGCCTTTAGATACGTTTGCAACGGGGGTCTTATGTAAAAGTTGACCAGGCTGCATTCGTAAGGTTGAAGACAGCCTTGATACGGTGTGATGTTCAGCATAGCTTCGTTTATATCGGGTTTGGCGCCTGGTACATCCTCGAGAATCTTGAGATAATCCTCCTCAACCTCAGATACGTTCTGTGCAATGGGGTAGAGATGATACTTGCAGAAGTACAACAGTTTTTTCTTGACGTCTGGAGGAATGGTTGGAAAACGCACGTTTTTCAGGAAAATGTTGCATATATCCGAGTACCTTGGTAGTTTGAATTCTTCAGAATGATTTTCCCGCACTAGATTTTCTATGATCTGCTTGATTTCTTCTTCTTTAGTGGGATCTACGTCAGGATATTCCTCAGTTTTTTTCAGGTTCCAGCTGGTGGCTTTATCCAAGGATGAGAGGTTATATCTTGGTGTTTCCAATTTTTCTAGAGTGTAAGATACAACTTCCCACTCGTACTGGTAAGCTACAGGCAGTGGACTGATATTTTTGATGATGACCGTTTTTTGCAGGTTCCAGCTGGTCGCTTTATCCAAGGATGAGAGTTTTTCTTTGTCGTTGAATTTGTTCCCCCTACTGGCGTTAAGAAATGTTTGGTAGCTAGCGGGACTATGAAGATTGGCTTCAAACTTCATCCGAAAACCTTTATGATTCCCTTAACTGGAGACATACACTATCCAACCTTGTTTACATACCCAGAAGCAATCAGGAACCATAATATAGCACCTATGGCTAACTGTAGCAGAGAAGTCATCATCAAAAATATCAGTCCAC
>TRINITY_DN57_c0_g1
GTTCCACAGGGTGTTAAGAAATTGGACTACAAATACATGGTTTTTATACCCTGTATAAAGGAGCCATCAACATTTTCGAAAAACTTTTTTGGAGATCGTTTTAACACCAAAAAAAAATATCTTCAATTTGAAGTAGATATTCTGCAAAATTTTAGGTGGCTAAGTTTTTTGATGGTGTATTTCATCATGATAATAATCATCAAGTGACTTCAGAAAGCTATTCGAATGAAATGACCGAATTTTATGCCATAGTGATGAACCGTATTCATTATCTTCTTCTACAGGTGTTCGCGAATTGCTGCTAATTTAGAGTTATATCCCTTTTTTTCATTCCAATAGGATGACGTTGAATAGTTTTTATGTTTCTGCAATGAAGCGAGTTGCGAAAACAATTCCACGCATCAGTTGAACTTCGCTAGTCTCGAAATGAATTCAGCTCCTATTTAAAAGGAAGATTTAAGATTCAAAAAGCATGAATAGTAAGATATCTGCTCAATCTCAGTATCTCACAGAAATAAGACTGCACAATGAATTTCGCAGTGCGAATCTTCCAGACAAGGGATGAACGTTCAAGAATGCGAAAAGCAGGAACTAGCTTAAACTTTCGACATTAATCAACGTTAAATATTCGCCGGATTCAATCTTCGAGCAAAAGCAAAAATAACCGGTACAATCGGGGAATGGATTCAGACAAATCAGTCTTCCGAAAACAACCGATGGAATGAAACTCTCCCAAACGTTCATCGGTCCTTCTCTCTAACAGTCTTTCCTTTCTATCTTCCTCTCAGTTCGTTATCTTATGTTCTTTTTTCATCTCGTCAATCGTTGCTATCGAAACCTTTTTCTCGTTAAGGCTATTATCCAGGGGAAATTTGAAACTCAATTCGCGATCATCGCAGAAAAGAGGGCTGTGATTATCTGGGAGGAAATCATTCTCCACGGCCAGCTTGTCTTCGTGAGTGTAGTATTTAGCTGCATGTCTTTTCGAATAGCAGATCAAACCGATTATGGCGAATAGAATGAGGAAGAGCAAACAGACAGACATACCGGCAGCAAGGATTCCTATTCTGCTGTTGTCGTTTATAGAGAAGAAATTAGCGTCCCCTGTTGGGTAGCTCATCGAAGAGCACCAGGTCAATTGGTTTCTGTCCAAGGCGTCCAACTTCTTACCTTCCACAACATATGGATGAGAGCATACGATATTCTGGAAAGACGAGCTCCTGTTAACCCTGTTCATCAAGGGAACGATGAAGCAGAGATCGCAAGACCAAGGGTTTCTGTCTAGGAGTGTCACGTTGATGAATTCGATCTTGTCCAGTAAGTCATCGTTGGAAATTCCTCTGAACATGTTCTTGGAGATGTCCAAGTATAGCAAACCATCTGGAAGTGCTTTACCACTCAGACCGCTCAAGTAATTTTCAGAGAGGTCCAAAGAAATGAGAGTAGGTGGGAAAACATCGTCAGCTACGTCGAAGAGTTTGCATTTTCTCAAACGCAAATCACGTAGTTTAGAGTTTTTTAGGACGTCTCTTGTAACGTCTAGGTCCAAGGGGTTACCGCTAAGATACAAGACTAGCAAATTTTCCCGAATTGAGTCGAACAGTTGCGGCTTTAAACCTTTGATCTTATTATAACCCAAGTCTAGCTCAGTCAAATTGTCGGCGTTCTCGAAAGCAGATAAAGAAATCGACTCTATCTCGTTTTTGGCCAAACTCAATTTTATCAGTTCGGGAAGATGGGAAAAGACGTAGTCTCCCAAGTGCTTCAGCTTGTTTCCGTCCAGTTTTAGGTGTTTCAGGCTCTGCAGGCTTCGAAACTCGTCCTTTTCAAGGCTCGTGATGTCGTTCTCGCCGAGGTCTAGATGATTTAGGTGTGGAAGCAGGGGGTAGATTTGCTTGTTCATCTCGCTGAGGGCGCATCCTCTGCATTCTAATGTTCTAAGCTCCTGTACATCTCTAAAAGCTTCAACAGGTAACGTCCTCACAGGGTTACCACTCAACTTCAACACCTTAAGCTTCTTCATCTCTTGAAACACACTGTGCGACAACTCATTGATTCTATTCCTCTGGACCGAAAGCACCTTCAGCTCTTTCAGAGAACTAAATGTCCCACTAGGTATAGAAATAATCCTGTTATCATCCAACATCAACTCTCTCAACTTCTCAAGACCCAGAAAATTCTTGTTGATGACTTGAGTAATGTTGTTCTGGGACAAATTCAGCACAGTCAGATTCTTGAGATAAAAGAAGAAGCCCTCGCCAAGCTGCGGAATATTTGAGCGAGTTATATGGATTTCCTCTAACTGCCTGTATTCTGTGAAAGCTGGAACCATGGTGAGGACATTGAGGTCGTTTTCGGGGGCAGTTATTACAAGAACTTCAGTGTTAAGATCCATTCCATCCAAGCTGAGGGGGCCGACAATGCCTCCTTCTTTACATACCACCGCGTTTCTGCCTTTGTTGTCAGGGACACAACTGCAGTTGTTCATACAGGCAGATCCGAGTCTCCATAGGATGCTGATTATCAGGAGATGTAGCAGCTTCATCCTTATAATTTTCCAAATTTTCCACCTGATGAAAATCCTTAATGGTAATCACGCACGAACTGATCAACACTCG
>TRINITY_DN100_c0_g1
CTGTCCTCAGATTACCAATATGAGAGATAAGAAAGATTCCCTCATTTCTTTAGAATTTAAGCTAAGGAATCAGACATTCATACATATATAACAGTATTTTTTCATAAACGATTTTTTTTCTTTGGAAATAAACTGTATCTCGCTTATGCTTCGAAAGCGGGATATTATTATTCATAAGGCAAAAATGATTCTCCCAGTGTCATATGCACGAATATATTTGTCCAGTTTATGATGAAACACCCTGTACACAGGCGTCCATAGTACTCGATCGATCGATAACTCTTGAAAATTTGGGTTAGGAGAATTATTCAAATTTTGACGGAATCGACAGTACACAGCGCATGAGCTTAAATTATTTTTGACTCTACAGGCTAGTCCAAAAGTGGTGAAACACCACCATGTTTTTTCAAATGAATGCCCAATTGTTATATCATACTCATAATCTCCATGAAATTTTGATTTCGAAATACCTATCCCATGTCATCAATTATCTGTGGTACTTTTTTGCCGTAGGCCAATTTTTTCGACAAATTTCATGAACATAATAGTTTAAACTGAAGAACATATCTTGAAAACCGTTCGAGATAATTGAGCGATTTATTTTTATTGAGTTCCTCAAAGGTTTTCAAGTCTTTTGCAAATTTAGGGATCACTCTACACATGGCCCGAAAGAAACTCCAATTTTTAAAAATGACCTTCAAAAAAGATCAATAAGTCCATTTATTCAAATAACATGTGTTATATCTTCTCTCAACTGATTGACAACTTTGATCCTTCTATCTCACAGTAATTTTGATAACTAAAAATATAACAGCATCTCCTAATTTTTTTTGCCTGTCGAATAGAATAGTGAATAGTCTTCATTTTTATTGATACTTGTTGTGCCTAAAATGGATAGTATTTTTCTTAACACAAAAAGAACAGACATTTCGATGAATATATGAAAAAATGTATATTCACTCAAAAGCTTCAGTAGTTTGGAATCATTGGAATCACCGAAAATATCAAAATTTGGGCACTGAAAATTGCATCAGTTTAGAGAATACTCAAGACGGATTTCAGAAAATTTTCCTCTTGATTATAGAAAGCACATAATTTTTGTATTCATTTTCAGTTATATATTCACTCAAAAATTTTTGTATTCATTTTCAGTTTTTGGTTCCACCATTGATATCAATCTAAAATCGACGAGTTGATCGATAGAAATCCAAAATCGACGAGTTGATCGATAGATCAAAGTTCTACGAAACCAGAAATTTTAATTACAATAACAATATCAAATATTTTAATACAAAAAAAACACAATTCTAAAGTTCGTCTTTGACAATAGAAAAAAAACAATTCTAAAGTTCGTCTTTGACTTTGAAAAGCCTCTCGTTTTCCCCGAAAGGAAGAGATTCCCAAAACTTGCGATTCCCAAATTCTTCAACTTCTTCTAGAGAGAATGAAGATAGAGAATCCCAAAACTTGCTATTCCCAAATTCTTCCACTTCTTCTAGAGAGAATGAAGAGGAAATCCTGATATATTTTATTGGGTCACCTTTGTTCTTCGATACTTCTGGCCACTCTACGTCACTTTGTTCTTGGATACTTCTGGCCACTCTACGTCGTCTGTGGGTTTTCCATTTTTGGCAAAACTGATAAATGTGTCGACCATAAACTTTGAAATGGCCCGATCTTCTTCTGTTGACAGAGTATCAACCTCTGTAGTTGACAGAGTATCAACCTCTGTCTTCAATACGTAAACCGTATCATCTGCTAATACGTAAACCGTATCATCTGCATGTGAAACGCCAATGTTATCCGTGGTTCCACTGCCCAATTCTGTCCAGCTATGTTTCCCTCTATAATCGAAGAGATAGTGGTAGACTGGAGACTCGATAGCTGCTGCCTGAAGTCTTGTACATTTGTCAATGTCAGCATTGAACAGTCTATCACTGAGTATATCGATCAATTTGTTGAAATTTTTTTGTGTTATTGGTTGTGATCCTAAGTATTCTTCCCTTATTCGGTCGTTCACATATTTTTGGTTAGATTTTTCGACTGTGGAGTTGAAGTGCAGTATATGGGGTAAAATATCTTCCCAATGTTCGTCTATATACTTGAGATTCTCCTCTGGGTAAAATTCTGCTCCTGGATAGAGTCCTTCACCGGAAGTATGAGATATTATCCATGGAGTATCTGATACATCCCCCTCTTCAAGAATCTGTAAGGGATGCTTTGGCAATACTGGATCGGCAGACCATTCGTCTACAACAGCTCCAAATGGAGAGAATGGATTGTATTTCCAAGGCTGAAACTCTCCCACAGCACCCACAATCTGCTTCGCTGGCCTCTTCCTCAAACAATCTACCAAAGACTGAGTGCTCTCTGCCTCGCAGCCTACCAAGGTACCTAACTCCATCGCCCTCTCAAGAGGATTCTCCATCAACACCCATGGATTCAACATACAACCGCTCATGGATATTCCAGCCTTAAACAGACCTCTAGACTCCTTAGTTAACGTGTGGAAATGTACACTGGCTCCTCCAGCTGATGTACCGGTAATAGTGATAGAGTTTGGATTACCCCCAAAGTACTGTATATTTTCTTTTACCCATTTCAGTGCAAGTATTTGATCTTTGAGGCCATTATTACCAGGGGAGACGTCGTCTTCAGTACTCAAAAACCCTAATGGTCCCAACCTATAGTTCAAGGTTACATATACTACATTCTTGTCTAAGAGTATATGTGGTTGATATATTGCGCCAGAACCAAACATGAAAGCTCCTCCATGGATATAAACTATAACATCCAGTTTAGCGTGAATCTTAGGGGTGTAAATATTAACGTAGAGACAATCTTCTGTGCCATCGATTGGATCGCTTTCTAGTCTTGCAAAATGATTGTATTGCATACATTCGTATTTGGTATTGGCCTTCCATATTCCTTCCCATGGTTTTGGAGGAACTGCTTCCTTGAATCTATACTTTCCCAGGGGAGGTCGAGCATATGGAACTCCTTCGAAGCTATAAAATGTCTTGCCATTAACTGTAGTATCTAGCTTTCCTTCTATTCTTCCTAATGGTGTAGACACCTGAGGAGTTGATTGGCATGTTGCGAATGCCAGCAACAACCAAATAAACCCAAAATAGAATCCGTTCATCTTGTCTTGTTCATAACCTAAACAAGTCTAACAAAAATATTATTCCGCGATGCTTTCTAAAGGATTCATTGTTATCTTATCTCGTATTAATTCATATTGCTTGATTAACCAGCTCTATCTTCGTACTGTTGCATACTTCTATTACATTCAAGAATAGATAGACTGTCG
>TRINITY_DN114_c4_g1
GAACCCAGGGGCGAAGTATTGCAACATGAACCCCCTACCACGGCTCAAACGGTTGAAGATGATATGCAAGTTGCCAAAAATTCGAATACCACACTAAGCAACAACTCAAGGAAGAAAGCTAGAAGTAGGAAACTCACATTGACGCCAACACCCAGTGAAATGGACCAACTCAGCAGCCTTCCCGTCAGGTTTTCATTGGAGCCTGGTTTTATTCAAGAGATAACAGCCATCTTCAAGCCACTCTACTGCGGGTTTTTCAAAACCTCGTACAGTTTCGAAGTTGTCGGTACTGGTTACAAGGAGAAGATTCTGGTACAAGCAAGCTGCGACTATCCAAGGATCGATACATCACCTTATACTCTGTTTCCACACAACGTTCAGAGCATAGATTCCAAAACTATGTTTTTGAATGGGGTTTATGTGATGTCCCAACAAACGTTGGACTTTGGTACAATTCTGCTTGTACCTCAGCATTTACTGGAAATGAAGAGCTCGATTTCTA
>TRINITY_DN34_c0_g1
GTGAAATAAAATTGCTATGAAAGTTTGTTATACAATCTAAGTCTATGTAAAAAAAAAGAGAATAAAACTATCTTCCGGTGTAACCAACCGCCATGAGATGTTCTGGAATTTTTATCTCAGGATGGAAACGTTCCGTTTCTTTGAGGAAAGCATATCTAAGTTGATCCGCTGTTAAGCTCTTCCAATCGTCAAAAGGCAACTTGACCCGCTCTATCGCTACTTGAGCTTCAGCGGCCAGATTTCTCACGTCCGCAAAAAGTTTATGATTAAGGGCTTCCTCCACCGTAATTCGTTTCTTGGGGTTGAAAACTAGCATTTTAGTTAGTAGTTCGAATGCTTCGGGAGATGAAGCTGGATACCTCTCCCTCAAATTAATCGAAGGACGCTGAGGGAAGATTCGAACGTAACGACGTGCATCCTCCTTTTCCAATGCTTGTATATCATCCTCGTTGGGAGTGCCCAAAATGGAGAATATTACATTCAATTGGTCTCGGTTTCCTCTAGTGTGGAATTTATAATCTCCCGGATGCTTATGCTCCGGCTAATGTTTGCAATAATGTTTCCAAGCACTGTACTACTTGATCGAGGCATTCCATGACTGGGAATTGTATCTTCTTCAAATGCGGTAGTATTAAATACTCGAAGGTATCAGGCGATGGGAATCCCGGTAATGAATCGCCTTCATGCATTCTTATAGCAGAATCTATCTCGGCGTCTGACATGCTCTCTGTAATTCCGCCGGCATTATTGAACTCTTGCAATAGTTCGTTGAAGACTGTGCGAATTTGATCTCCCGGATGCTTATGCTCCGGAGATAAAGGGAAACAAAAGTCACCCGGGAATAGGGGACCTCGTTCAGCATGGTGAGGACAATTCTCCGCTATCATGTTCATAAGTTCGGCGAAAATGCAGCCAACTGACCAAACGTCTATCGCCTCTGTATAATTTTCCTGCAGGAGGATGAGTTCCGGAGCGCGATACCAACGTGTGACTACGTGACCCGTTAA
>TRINITY_DN61_c0_g1
GAAATGTCCAATGCACACCACACAAACTTGCAACCTGGCCCTTTCAATAAATAAATTCACCACAGTCCGATAAATTTTACGATCTTTTATCATTTCTGCGAGTTTTTATTCAAATGACCTGTGGTGGGAAAGCACAATAATCGAAAAGTTATCTGGATCGCTTGACCAGTGGGTGATGTGTTTCTATCGATGACAAACATTTCTCCGGTATCATTGAGTGATCCTCGTTTCGATTTGTGCTCCTACTTACCCCATTCGGAGTCAAAATGGGAAACAAGAATCTGTACAAACCGTGCATACATGGCATGTCCAAAAGATGGGACAAAAAAGAATGGTCAGATCGTGATTTATAATTTTATGTACCTAAATTTATTTGATGTTTTTGTCCAATTCACCTTGTTTTCGTTATTATTAAAAGCATATAAAATAAATCGGGTTGTCATTTCAACTTTAAAAATAAATACATGATAAATTGAAGATCTCCTGGTCTTAATAGTAAATTGATATGATTGTTGAATGTGTTCTTCTATAACCAAAGTCACATGAAATGGAACGTCATCCAACCCTTTTATGGCAAAGTCACCACACTCCGTTAGGGGGATGGAGGGTGTAAATGGCAGGGACCCCTAAGTTACCATACTGACGGTTCCATCAGTGGTCCTATGCAAAGTTGACTATTTGAAACTTTTTCCAGGCATGTCCAAAAGATGGGACACCTCATCTCTGACTGTAAACAATGATATCGAATCATATCAACTAATATGCACCTATTTATTATCACTAATACAGGAATAGAAAAATAACGCATGATGCGTATATTTGACATTAAATATCATTGTCTAAATGACGAAATGAGTTAATTTTGTTTATACTTTGTTCAGTAAAGAGTTTTTGGATTTGAATAGGCATGTCCAAAAGATGGGACAAGGTCGACACGCTTACATGACGTGCCATGAAAATCATTTTTCTTAACATTCAATTTTCGACTAAAAATAGTGTAGGATTTTATAAAAGAAGTCTGTGATTTAATTAAGAGTTAATTTTATTCCTGAGATGCCTTGAAGGATGGTTGTTAAAAAAACAAATGAGTGATTCAGAAAGTCCTAACCTTGAATTATTGTAAGTTTCGATTTTCAAAGGGGTCAGAACATGAGAGGATTGAATGTTGACATGGACTGGAAAAGCATGTCCAAAAGATGGGACAAGCTCATGAAGAATTACTGGTGTGAAGCCAGGAGCTTTTGAGCGCACGTTCATTCATGCGTGTCAGATTTTTCACGAAATAAAAATCTTCTGTGTAAAATCCGCTACATCTTTTCCGCATAGATATTTTGCAATATTAGTATGATAAAATCCCCGATGTTGCTCTTGTACTGATTCATGGTCATTACTAACTGACAGTTCAAAGTCCTCTTTCCTATTTCACGCACCTATTCACAACAATATATACATCAGACTGAGTTAGTTCAGTATGACGGAACTAAAATGCTAGGTTAGGTTGATCAACCTCCCAAAAATTCTTACATTTGTTGCTTCAGTAAAATCGATAGAGCCAAAATGACATCTAGGGCTAATTATAGATACAGTGTTGTTCAACCTGTTACCCAAAGAAAATGCATGTCCAAAAGATGGGACAAGTTCACGTTACTTATGTGGAAGAACTGGATACTGCAATACAGGAAACCTCTACAGACTGTGATAGAAATTTTAGCACCCGTATTATTTTCAATATTGTTAGTTATTGTAAGAAATTTAGTTGAACCAACGCACAATCCCACATTGTTGTTCGAGCCATTTTGTCCAACGTCACCTTTGAAAAGCGATGTTTTTTCTTTCATTTGTGACCTCAAAGAGAACACCACCTCCAAAAGATACAACATTTCAGGTGCAGGAAATTTCAGGTGAGAGTTCGATTTTTAATTTTTATAAATTATGAACAAACTTATCTATGGCTTCCACGGCTACGGTTGCAGCACCATATTCTTTTGGAATAGACGTTATCTCACGTGGCACCAAAAAAAGTCCAAAGGTGTTAAAACAAAAAATCTCGATGACCAATTGTACTTTAGCCATATTGTATACACCTATCAATGACGACACGGAAAGAATTATGCAACTTTCCCAGTTTGCCAGTTTAGACACTATAGGCTTCAATACTTCTCAAGAACTAGTCGATTACTATAGAACGAATCAAACTATTCTGGTTGGATTGGAATTCGGTGAGATGGAAGAAGGAAAAGATATCAACGTGAAAATAAGATTTCCTTCAGAGCTTAGAGTTCCTCAAGGAGCAATTGGTGGCCCCACAGACTGGAAAACTAATCAATTA
>TRINITY_DN8_c0_g1
ACAGGGACTTGAAATCAGACAACCTTTTGATTTTTGCAGACAAGTCTATCAAAGTTGCTGACTTTGGAGTGGCCCGGATTGAGGTGCAGACAGAAGGAATGACACCTGAGACTGGAACCTACCGCTGGATGGCTCCGGAGATGATCCAACACAGGCCTTACACCCAAAAGGTGGACCTCTATAGCTTTGGTATCGTTCTGTGGGAGCTCATAACTGGAATGCTTCCATTCCAGAATATGACAGCTGTTCAGGCCGCCTTTGCAGTCGTAAACAAAGGCGTCCGTCCTATCATTCCCAATGATTGCTTACCTGTATTGAGCGACATCATGACCCGGTGCTGGGATGCCAACCCTGATGTTAGGCCGTCATTTACCGAGGTGGTCCGAATGCTTGAGAATGCGCG
>TRINITY_DN31_c0_g1
GAACGTCAAATTTTATACTTTCAATAACAACTAACAAGACAGTCAGTAGTCAGTCAAATCTCTTTGTTAAACATATTCCATAATCATATAAGTAAAAATAAGAGGAGTTTCCTAGTAACATTTAAATCAAGTGTCTAAATTTGTGGAACTCATGGATCGAGTTATCATGGAAAGTCAATCAAACGATGAGAGCTGGGTAACTGAGAACAGTGAGAACACCTGTACCCATACTACTTCAACTCCATACTTCATAGTACCAGAAGAACGCTTAAGAAGAAAGCTACAGTTTCACTTCATGAATCCTATAGAAAAATGGAAAGCTAAAAGAAGATTTCCCTACAAGTTTATGGTACAGCTGGTCAAAATTTTTCTGGTAACTTTGCAACTATCGTTATATTCTTATTCAAGGTATCATTATGTTAATTACACATTTGATAACCGTGTAACATTCTCCCATCTATTTCTGAAAGGCTGGGATGCAACTAGAGAAATCAATACTTATCCTCCTACAGCTGGACCTTTGGCTATATATGTTAAAGATGATTTTTATTCCACAATAGAATTTGCAGTTGAAGGTTACGCCAATTTAAGTGAAGCAATTGGGTCGTATTCATATACCAACGAAGATAATTCCAGGCCTGATATGGTTTTTTGTTTATATAGTTATAAAGAGGGGGATATTTTTGGTTTTAACGAATCTTATGTTTTCAATTCAGAAATTGTAGAAACTTGCAAAAATTTATCACAGAGTGGGTACAGCAATTTCAAAGCCAACAAATTTTTCGAGAAAAATGAAATTAATTTTTCAGCTCTAGTTAGAGCAGAATTGAAATTTTCACTGAAAACTGTCAACTTCAAATCAGCAGGTAGAATTTCACCTCCTAATTGTTACCAGTTCGACATAGTTATCTTATTTGATAATGAAGACCACGATGGACAACTGGTAGTTACTCTTGATGCGGAACCAACCAGATTAAAATGTAAAGGTGATGTTGAATATGTTATAGGAAATGAAATAAGCTCGATATTACGTAGTTTGCTTAATTATTTTGTCATTTTTATCTGTTTTGCTTCTCTACTTCTTTGTGCTAGAGCTCTCTGGAGAGCCATACAGTTGAGACAAATAACAGAAAATTTTTTCATTTCCACTTTCAATAAACCCCTGAGTAGCAATGATAGAGGTAAATTTGTGAATTGGTGGTATTTAATGATAATTGTGAATGACGTTTTAATTATTGTTGGTTCCTCTATTCAACAACAAATTGAGAGTGATGAATTCAGCTCAGATCAGTGGAATGTTTGCAGTGTTTTCTTGGGTTCAGGAAATTTATTGGTTTGGTTTGGGGTATTGAGATATTTGGGATTCTTCAAAACATACAATGTCGTCATTTTAACTTTACAAAAAGCTGCCCCTCAAGTAGCAAGGTTTTTAATATGTGCTATTCTTATATATGCTGGATTTCTATTTTGTGGATGGCTAGTATTAGGACCTTATCATCTGAAGTTCAAATCATTATCTACAACTTCAGAATGTTTATTTGCTTTAATTAATGGGGATGATATGTTCGCAACTTTCTCTGTGTTGAGTACAAAATCAAGCTTATTATGGTGGTTTTCCAGAATTTATCTTTACACATTTATCTCTTTGTATATTTATATTATACTCAGTTTATTTATTTCTGTTATCATGGATGCTTATGAAACAATCAAACAATATTATGAAGAAGGTTTTCCTAAGAGTGATTTACAAATTTTTATTGGGGAAACTAATTTAGACGACCTATCAAGTGGTCTCTATAGAACGGGATCTACAGAGAGTTTAGGGGGTTTAGTAAAAGATTTCTTCTGTTGTTTTAAAAGCACAAAGAACTATACATCAATTCCATCTCCTGAAAATAGTTGATCTCTTTAATTATAACTATATTGAGATTTGTTCTACTGAGAACCAAAGAGAGATTAAATAAACCGCCATGTTTTGTTTTTATTTGTAAGTGTATTTTATGCATTGAAGTGATTTTTACCATATAAATTTGGTCTCAGGTATAATAAGAAGTTATAAAAGAAGAGGTTTATATAATGAATTAATCAATTGAATGTGTTTTTTATGCAATTTTATCCTTATTTAATAGTTATTTTGTATATAATCAATAGAACGATTCAATTGTTAATGATCTATATAGGCTACAGAAAAAATTCATTGAAGTCCAGTAAACATCAAAGTCTCAAAAACTACTTTTGATAGAAAATGTTTTTATTTTGAGATTTTATGCGTCTGATTTTATATTTTCGATAACTTTGTTATCACATATTTGGTTTCCTCTGAGACTTATAATTTCTTGAAATAACTGATTCTTTGAGGTGTATATTTTTCCTAACTATTATCATTCTGGATCAATAAGGCTGAATAAGTACAAATTGTACAGTGATTGATTAATTAATTGATGTTGAGGATATTAGGTTTAGTCATATCTTCAGTTATTCTTCCATTGTGAATCTATACACTATACTACTCTTACCAAATTATTATTTTTGAATTGATTTATATTTAAGTGAATATTTTTTTGTTGGATGCTATGCACTAGTTGATTAGCCACATATACTTCATGTTGATTTTGTTTAAAAACTGATATATCCTTTCATTATAGTACAGACAGAGTAAAGTACATTATGTAAATTGATGTATATATTAGTTTATAATAATTAATAAATATTTATAACAAAAAAC
>TRINITY_DN124_c0_g1
GGAGATTACACAAGGGAGAGTGACGTCAAGGAGGGCTGCTAGGAAAAAATGATGGGAACTTGTCATCATATTTTTATATATTTTATCTGAATCCGAGGTATTTTCCACATTTTTCCGGACACCCTGTATATCAAAGTCATATATGTACTATGGTCTAATGGTATACAATGTACCTATTTACGTACATACATATGTAAAGATTTCGTGGAATAAGGGCCTGGAGATTACACAAGGGGCGACTCAGGCAGATATAAAAGAAGCTTATTACAGATTATCTATGAAATACCACCCTGATAGGAATAAAGGAGAAGAGGCTGCTGTAAGATTCAGGAAAATAACAGAAGCTTATGAAGTATTGAGAAATGTAAGGTTAAGGAAGTTATATGATAAAGGACTAAATTTGAACCAGAGACATA
>TRINITY_DN171_c0_g1
TTGAAGAAGCGTGACCTAGAATGAAAGCGTACGGGCGCATTCGCCACTTTGTTATTCTCTCGGCCTTTCCATTCGTCCGAGATAACCTATCTTCGTTTAGGAAGCGACTACTTCTCAGAACCAATCACGCATGGCATCCTAGTATAAGCAGATTATTATGGGCATATTTCTGAAAAGAGCTAGATAGAAAATCGGAAATTAAATATCCTGTATTCAAAATGGAACCTGAAACACTTAAGAGGGGTCTACACTCCACAGTCTATACATACCGTTTCAGCGGTCAGTTCAAAAATAAGTAAACCATGTTTTATGCTAGAGAGTATCGATTTATATAATGTTTTCACTTTCATTCATTTTAAAG
>TRINITY_DN130_c0_g1
CGGAGGTACAAATGAAAATGAGAGATACTTCAGATAATTTTAAAAAGAAAAAGTCCTATAACCTAGGCAAATGCCCTATTTTGGAGATAAAGATTGTTGAAGTTTGATCACATATCAATAATCCCTCCACAAGATATTCAACTTGAATTTGGCATAGGCGGGCCCATGTTTATAGGACGTTTTTATCTTAAAATTATACAAGGAATCTCATTTACAGTTGTACCTCCAATTTAGGAACACCTTGTATATGTAATCTACCATTCCTAGTATTGAAATAGTGGTCTTGTTAATGCAGGTGAAGAAAGG
>TRINITY_DN66_c0_g1
CACTCAGCACCAACGATGAAATCAAGTCGGAATCTCTCAATGTGAAATAATAGTAGAGGTTCATTGTGGCGCTGACAGCGTGCATTGGAATTCCCACCAATAGGAATGTGGATTCGGTAAAATGAGAAGTTTCTTCAGTGACGTACTCTGTTATAAGAGTACCGCAGATCAGGAAGTAGGTGAAGGCAGTGCACTGCAACAGGTGGTAAGTATGTATGCTGTGGATCTCGATATAGGTGGAATAGATCAGATAAACGGTGACCACGCTCAGAATCGCCTCGAGAATTTTCATCCGAAAGAAGAAAAAAAATATGGGAATCTGGCGTTGATCTCTGGATGATTTTAACCATTAGCATTTGGAACATCTCTCAAAACATTTTCTGGGTCAAACCTCGAACGTAAATAAATGGAACGTACGAAGTCAAATATTTAGGAAGAACTTGTTCCTTTGCCATTATCAGATAGATCAAATAGAGCAATATTTGTTTAAGTCCTCAACCTCATTATCCTGATAGGTACTCTCATTTTGTTGCGGTTAGCTAGACATAATATTTTTATCTCAGAGTTTTTCTATTAGTGATCCAAAATGACCAGTGTAGAAACAATTGGGGCTATTGCAGTTAGAGTAGTGAAATTGGTCCTCAACCTCATTATCCTGATACTGTACAGAACAGGCAACCATGGAAAATTTCTTGGTGTCGGAGGGACCTGGAATTTGAACGAAATAAAAGCTCCAGATGTTGAAATAATAGCTTCTGGAGTTTTCGTTGGTTATTTCATATTCACAGCAGTTTCATTGATGAGCCTCCTTTTCGGTACCAGAGATAACAAGGTGTAAGTAAACGTTGCAATGTATATCGAGAATTCCTTGACTCAAGGATAATTCCTCTTTTCTAGATATTTCACAGACGTGATCATATTTCACAGACGTGATCATGGGAGTCATTGGAGTCTTCATGTGGCTCACAGTTGGAGCTGCAGCATTGCACTATTGGATTGGTTACATCAACGAGAAGGCGTTGCACTACTGGATTGGTTACATCAACGAGAACAAATATGTGAATGTTTCTTCAGAAAGAACGGTGAGAAACACAATGTTTTGAGTATCTTATCGCTAATTTTGTATGATCTATTTCAGGTTGGCTTGATCATGGGATCACTCTGTATTGGATTGATCATGGGATCACTCTGTATACTCACAGCAGCGTTGTACTTGTTGGATTCTGTTGTTTCCGTACTTTTTGTTGTTAGAGAAAAACTAAATGGACAATACTAAGAATTTCCAATGTTATATCTCAATGCTATATGAGACGTTTGTATTTTGTATTTTTTTACTATAAAGTAAGACCATTCAGTCCATGAAGAACTGAGTTTCAGAATGACAATAATCAATATTTTAGTTTAATTGAGATTTCCCAAATAAATCTCTTCACTATATCATAATCAGATTAAGAAGAGGATGAATGACTTTATTATCTGAAGAGATACTGAATGCTTTTTCTGAAACATTTTTATTGATTTATGACATTACACTTTTCAAAGCCTTCATACTGTACAAATTCGAGCATGTTAGATCAAACCATCTTATTTCATGAACTTATGTACCATACATTGAATAAAACCGATTTTTTTTTCTAAATTAAGGTATGACTACTATGTGCCAATCTTCTTGGGAAGTAATATCTGTCCCATCCTCCTAAAACTCTTTGGATTAACCAATCTGTCAAAGATACTATTCCACATGTTATCATCATCACTCCAAGAGGTATCAAAGACATACCCTGTATTTCCACATGTGGCTTAAAGCAAGCTAAAATCCCAAAACCTAAGTTGATGATCCCTAATACGAAAAGTGTGGTCTTCTCTAGAAGTACATTGGGACGATCCTGTATATAAGATACTATGAAAACTACGGATATCAGCAGGTATCCTGCTGAGCCGCTTATGAAGAACACGTGGTATTCCCTGTCTATCCAATACCTCACATGATTTCTGGCCAGATGTACACTCAGCACCAACGATGAAATCTAGAAAAGTAGTATATTTTGTTAGGAGTCGAGAAAATAAGTATTTGGTCTGCAGGTAATGAATTGGACCTTTTTTGCAATCTAACCAACAATTTCTCGTTTGAGAAATTCAATCGTTTTTGGTGAATTGATTCACATTTACATTTTCTTTTACCACAAGACAACTTTTAGCCTCGAGAATTTTCATCCAGAACCCTGGAATCCTGATGACTACCCAGAAGTTGTTCATTTTCTAGTGGGGCCTCAAGTCTGACCCAGTTGAAAGTCATAATTTTTTCATTGTGCTTGACACGTGTCGTGTTGAAAATGATCTATACTGAAATCTATGGGATTGAT
>TRINITY_DN15_c0_g1
GGACCTGATATAGATTTGCCCGACATTGAAAATACAGTCCAGCTCCCACGAATGTGCGTACTTCTAACGCATTGATTTTTTTAATACAAATATGTTTCCTCTATGACTAGAGACTTGCCACCTCTTCCTAAATTTCCAGTCTGTCCTGCGAGGGCTAATCGTGGTGGCGCAGCACAGAGGGCATTTGCCGCCCAAGCGACATGCTTAGCGCCTAGACCCGATGCTGACAAATTACTGTCGTGGACGGAGATCGAGAAACACAACTCACCAACTGA
>TRINITY_DN123_c0_g1
GCCGGTTCCGCTCGCTCCAGAAGACCGCGAGAATCTCGGATCGTAGCTAATTAGACGATATCTAATCGATGAAGATCTACTTATTGGTGATATCGAATTGATTGATTGTGCCACCCATTATTCTAACTGATTTCGGGACTGTCACTCTTGTTGTATATTGTTCTTCAGTTTTTAACAGTTTGTTAGTGTTGATTACTTCTTGTGTACTGTTTCTTACTTAGTGATGTTGTGGTATTGAAGATGTATATTGTGTTGAAATGAGTGTTTACATGGGTGTTTTGAATGTTATTTTTGCCACACTACTGGTTGTGCCTGGTGGTCTGTCAACCTTGAAAGCAATTGACGATGGAGCATCGCCTAACGAGTTAGATAAACCAATTCCAATGGACTCCGTTCAAGGAGTTCTACGTCAGAAAATAGGTTTGCCG
>TRINITY_DN129_c0_g1
CGAAAGGTATAATTAAGTAATTAGGCAAAAATATCTTTCACCTGTTTAATAAAAACATCTCTTTTTGATTATAATTTAAAGTAGGACCTGCCCACTGAATAAAATTTGAAGGGCCGCAGTATTTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTGAAAGCTTGTATGAATGGTTTGATGAGAAGATAACTTTCTAAATTTTATTATTTAAAAATTTTATTTTTAAGTTAAAAAGCTTAAATTTTTTTAAAAGACG
>TRINITY_DN120_c0_g1
AATGTTTTCTAAATGATTAATTCTATCGGCAAAAGGAATTTCCTTTTCTCTTGAATTTATTCAACTGTAATCATGATTTTTTTATCTGGGAATATACTTATTTGAATGATTCCCGATTAAATATACAAAGTTGAATATTTGGAATCCGACATTTTTCCCAATTGTCGAATTCATAATAAGCAGAATATCTATTATATTCTGTATCTACCTGCTGTAATCCAAGGTTTTGCAACCTTTGCTCTCCCAGTCTCATCGGTTGTTTCACGTCGTTTGGCGATCTTGAAGTTTGTTTTCTGAATTTTTGATATATTATGGTATTCATTTCAATATATTTTGAGTTGAAACGGAACGTTGATTCACTACGGGACATAAGAAGTGCGTTCTTCGTG
>TRINITY_DN106_c0_g2
GGGGAAGTCACATTGAAATGCATAAGGTCAGGAAGACCTTTGATACATCTTATGAAAGTATGGGCAATTGTTGGTCCCCATTTCATGCAAGCTTCGTGTCATAAAGACAGAGCTGTATCTAAGAAAGCAGTCACTTGCATACACGATGCTGTGACTGCATTGTTCAATGAGCAGTCTGAACTACCCCACTTCCACTTCAATGAAGCTCTAATTAAGCCCTTCGAGAACCTTTTGTGTTTGGAGTTGTGCGATCCTGATGTGCAGGACCAAATAGTTTCTTGTCTATGCGAATTTGTGGAAGCTAACAGGACGGAGATCTGTTCTGGATGGAGAACCTTATTTGGCACTTTACGTGTTGCTAATGCTAAGAACAACGCTCCAGCCATTTTGGAAGTTTTCCGTATTTTCTTATCGACTGACAATACTTTAGTGTTTGCCAATGCTGCTTTGGATTATATCCTTTGTCTCTTAGCCCATATAAGGTCTAGCACACCCCCTGATGACCAAGCACCTTCAGAGCCACTAATCAAAATTTCTCCTGTTGAAAAACAGAATATAATGTTTTTGGATAAAGGGCTGGACTATTCACCTAAAGGTGGTCCTATAGATTTATGTGTGGAGTCACTCAAACTCCTCCAAAACTGCGTATCCATTTTATCGATGATGTACAACATGCCTAAATGTCCTACCTTCAACCTTACACATAGGATGACCATCGACACTGAACCCCAACTAGTAGATAGGATAATGCAAAATATGGAATACATGAACATACAACAAGATGATGAACTATCCATCAACGTACCACATGAAACATTGTCAACTTTGAACGAAATGAAGCTTTGCGAGGAAAACAGAATCACTTTATCCAAAATGGATAGACCTAGTGGAGTCTTGAAGATTTGGTATGTCCTTCTGGAAGGTTTATCCACAGCTGCTACAACTTGCTCGAACACAAATCAAGCTCTTATTGTTGATACGTTATTCACACTCTTGAGAAACTTGATAATAAATCCTGGTATCAACTTTGGTTTTTACTGTATCAATCATCTTCTCTTACCAATGGTACAAAATTGGTTGCGACAAATCATGAAGACGTCTGATAAGACCGGAGAAGTTTGGATGAATTTCAAACATTGCTGTGGTTTAGCTACTGAACTTGTTGTTGATTACATGCACCACTCTATTGAACATAGAGAAAAGGAAATGATAGAAAAGTCACAACAAGATCAATTGTACAACAACCCAGCAGCTAATCTAGCATTTAAGCAACTGCTTATAGTTCTAGTGGAAATTGGTGATCAACCCTATGAAAATTTCGCTAGATTGGGAACATCCTGTATGCGCCACATTATTTTGAGCGCTGGTAAGATCCTAACAGCTCACCAATGGGAAATATTCGTAGTGTACATCCATAGGGCATGCACAATAAGCTTGTACCCCTTACAACAGCTCATCAATGCTTTCAAAGAGAACTCCGACAGCTTCTACGGTGATCTATCTGTGGTGAAAGTAGCTGCAAGAAAAGATTCATCTGTTGAAGAAAATAAAAGAATATACGAGCTAGCTAGACAAATATTTCTCATGCAATCCCAAAGACCCAACTGTAACAAATGTATTGGAAAATTATGCGATTGTGATATCCCTAATGGCATCGTTATAGATTCAAGAAGTTATGTATTCTTATTGTACTCCCTTGATCCAACTGCTATCCTAAACTCTGACCTGTATGCCACTCGAGTACCATTTAGAAGACTTGTGGTCGGTATTTTAGCTCATGAAATGTTGATACAAACAATTTCTAGTGCTCTACTGCAGAATTTGAATCATATCACCCCAATTCTTAATATTCTCCAAATAAATACTTGCAGTTTGAGAGGGATATTGACAAATGTTAATGCAAAACATGTCGACATCATGCTTAAATGCCTTGAAATATCTAACGTAAGAGCTAAGCAGTTCGATCAGCGACCTGGATTGAAGTTTTTAACACAAAAGGTGGGAAATTTGAACAAAGCAGCTAACTTATACAACCAAGCTAACACATCTGAAGTTGTGCAAATTATTGTGTTGATTGAGCTTTGCCTTGATGGTATCAAGAAATACAACATTAACCCTAAGGATCTCAAGGGAATTCTGGCGCAGGATAAAAAGATAAATCCTTCGACGGATCTAGAATACGTTCAACAGTTTCTTATAAAGCTTCAGAGTAAATGGGAAGCTTTATGTGAGTCTTACGTTAAGTTAACAGAAGATTTTGGCAGGAAAATTGAGAGTGAGAAAGTCGAGCCTGATCATAAGGAGAATATCCCGAAAGATATCATCAAATCCAATCCGTTGAAATTAGAAGATTTAAAAAAAGACGATGATTATTTAAGCACAGATTCTGAAAGTTATTTAGAAAGAGATGCAATAGGGAACGATTACATAGAAAACGATTCAGTTTTTGAAATCCAAGTGAATAGGTCAGAATCACCTGAGGACAAACCTAAGCAAAGTGAAACTTGTGCTTCTACAGATGATGAGACCAACGAACTGGCAGCTAAATACACCAAGCAAATTTATGAAAAATATAAAGTGGAACTGAGTTCTATCAAATACGATACTAACACCATTCTGCAAATGAGAAAATCTGCGTTGTCCGATGATAATATCGTTGCTGGTATCTACCCAAAGAATGACGAAAGGTCAAAATCTGAAAGTTATGATATCTGCTCTCATAGTGATAATAACTCGGAAGAAGAAACCAAGAAACCGATAAGAAGTGCCACTATTACTTCGAGGGTAAATCCGTTTTCGGTTTCTACGTACATTCCACCACCTCAACCTATATTACCAGAAATCCAACACCAAAGATCTATCAGCATATTTAAGGATGTTGAAGACTACAAAACGGCAAGAATAGAAACTATGGAAGCATGTTTGGAGCTTCTTGGTAGTCTGTCTTCTGATAGGTTAGGACCCTTGGCTTCAGTTCTGAAAGATGGAGCTATAATGCTAGTGAGATCTCAAGATGACAAAATCAAATTGTCTGCTGAGAATTTGTTACAGAGAATGAATATTTCTTACATTGATTATGACAATTTCTAATTTATGATACATTTCTATTGTACGTATTTTATAACATATGATACATGAATGTTATTCAACTACTCTAAATAGCTTATATTCCAGTTCAAATAATGCAAAGTTACGAGTGAAGACGAATTATGAAATTGATTTTACTAAGCAATATTATAAATTATTTTACGGTTGTACCAAACTGGGTTATTCATCGAAAGATCTTTCCTGCAAATTCGATTTTAACTCAATCTAACGTACCCCAAGAATATTCACAGAATGTTAGAAAATCTGTAGATTACAGAATTATATTTCTCGCTCGTGTGTTTGCAGCACTCGCCTTTCAGGCTCGTTTTACAAACTTCCACACTCGCGAGAAAAGTTGGACTTTCCCTACTTGTTGCACACTATACTATTTCAGTTTTAACTTAGTTTACAATTAACTCAAGATTTTTTTGTTCAACATCCTATATAATTTTTTCTGACTGTTTTCGATCCTCTCAAATAACCATGATAAAAAAAATGAAAATTATTTGGAATGAATCCTTAATATTGCACACCAAAAAATATTATCTCAAGGAATATTTTCTTCGATATCTTGAAAAACACGAAATAACTTGAAATATAAAAATGAAAAAAGTGTTGTATGAATCATTTCATATAACAATAAAACTTAAGATACACTATTCCTTGAATTTAACCAGCAAAATTGTCTACAGAAAAAATCTATTAATCTTATACAAAATAAATATCACCTTGAATAACGGAAATGATTATTTTGATTTATAGGTATATATTGGATTTTGATTGTTGTGAAACTTTGAAAAGAACCCACATTCCAACTATGCTTTACCACAAAGTCCTTAGTTTTTTGTAGTTTCGAGGATAAAAAAACTTTTTATCCGATATAGTTTATATTTTTATATTTCGAGTAGTTCTAGTTGATAATTTGGTACGACGATGTATTGAAATTGAAACAAGGTGAAAATAATTGCTGAAAATATTTATTTGGAATTAATAATAAGTAATACAATGTTTGTAACAAATATTCTAACCTCAATAAAAATATTTGTTTTTATTCTGACTTTCATTTTTTCAGTTGATGGAGTAACAACTACAGTACTTGAAACAATGCAAATGAGTATTTACATTAAGGAACTAATATTTCGTTTGCATATATCTTATTATGAAATCCATAAAAAATTACTTCGCTTAACTGCTATTTTCCCTGCACAGACAATATAATAATAGCTGGACTTGTATTTTGTCAGCATTTGAAGAAATAAAATTGTTTCAATTTGTTGAAATCTCTCAATACATTACAGGGTAGCCAATAAAAAATCAAAAAAGAAGTATTTAGGAGTAAAAAATTTATTAGGAATATTTCAATGAGTCTCTTCAATAAGTGAGCTATTTCAATCAATCTATCATAACCTTAATTCTTTATGCCAGATTTTCAGTTGGCCAGCCTGTAAATCATTCTATTCCCAAAATGTTTACACTATATACAGATTGGAGGAATTTTAACAGTCTTAAATAAATAATTATCATCAGATAGACAATTATACTTTGTTGAATTAAATAGTAAATACAAAAATTTGTTGATTTATTCTTTTTGTATAAGTAATTCATCATTCAGGCATCTTTTTTTTTTTTCGCGGTGGCGATTTAGTTTTTTCCGTACCAGAATCATTATCCGAACTATTGCAATGTCCACTTTTCTTATCTTCACTAAAACTTTTACTTTCACTTCTACTTTTCCTCCTTTTCTTCTCCTTGAGAAAATCACAGACTTGAATATATCTCTGCTCCCATAGAAGGGTCTGTCTTTGCTCGATGTCAGGATGTTTTGCTATGAAATCGAAATCTGTGTCCAAGTTCAGTTCCCAACCTTTATTGTGCCTAAGCGAGGAAACACCTTTGAAAATTTCCTTAACTTCTTCAGCTGGAACCTTCACTATTGATGCCACCTTCTTACGTTCAACAAATTGATTTTTTGTAAAAAGATAAAGCTGAAAATCGTACTTGGTTTTAAAGAAACGTAAAGCATAAATTGATTGTCCTAACTGGACTTTTGATGGCCAGATAATGTTACTACAAGGTGCTCAAGAGTGGTCAGAAACCAAAACAGATAAGTGTTTGTAAAACGATTTTTAATGATAAAGTAACATAACCTATTGAGCAGAAATGACATGAGAAATATCAAAAAATAATACAGTGTTGCCATTTCAAATTTTCTCAGTAAACATCGAAAAAGTATCGTTTAACAAAAAAATGTCATCACAATTACCGATAAACAATTCTAAATAAACTCTAAAAAAACATTTTAGTAGAAATTATTACTTACCAGATAATCCCTAGCTCTACACAAGATAATCCCTAGCTCTACACATGTTTTCGGAAGGAACACCACAAATAGGAGACATAGTTTCAGGCGGATATAACACCTCTGACTTTACCACCCAATTACCTCTAACCAATACAGCAACCTTAGGAAGCGTCTTCAAAAGACTATCATTTGTTAGGCCTGACGAACCAGCTAACAGCATCAAAATCTGTTGAAACTGGACTATTTGAGAACCCTTCAGCAACAGTCTGCATTGCTCTAAGAGAGGCAAAGCTCTGAGCGCATTGAGAGATATTAAATGCGAAGGAAGAGAAGGTTCATTGATTGATTGCTCCTCATCTTTTGGTACAATCTGTTTTAAATATTCTATTTCTGTTAAGTTATTGGCTTGATCAGTCTCATGCATATATTCAGTGAATAATTTCTGTTTTTGATTCTTACTAATTGTATTTTCTGGTTTAACCAAATCACATTCGATCCATTTTTCACTAGCACTTTTAGCAGTATGATTTTTAGAACTTATCATTTGTTTTTGATTTGACCGAGGAGTTTGTTTGAACTTAACTGTAACTTGTCGTGCACTACTAGGTCCTGCTTCATCGTCTGAGCTAGCAGTTTTCTTATTATTTTTATCTTGTTTTTTTTCAGGCTGTTGATAATCAACATCTAATTTAAATACATTTTTAACTGTAGTAAGATGGAATTCTTTACCATTGAAGGCACCAACAGTAACATATTCTGGTTCACTTACACTTTTGCGTGAACTTATTGACACATACTCCTCTGTATCATCCTCTCCAAATTTTGTTCTTGATCCATTGAAACTGGAACCAGATTTCCAAATCCATTGAAACTGGAACCAGATGTATCCATGCCAACTTTAAAATTCAACTCTTCATTTTCAGGCTTGAAGTTCACCTTATTAACTTCATCTCTCAAACTAGCAGTAATATCACATTTGTATTGAAACAAGTAGAGGTTGTCTTCTAGATTTGTCGAATGATATACTGGGAACTCTGAAACGACAGGATCATCATCGCTGTCACAGTTGCCTGACTTGTGAAGCTCCATTTTATCTGTTAGAATTTTTTACGGTCTTTCATTTAATTATTTTCATTTATTCAATTTTGAATTTGGCACGTTCCTAGGTTTACAACTCCATAATACACTTGGGCAATAATTCCACATTCTAG
>TRINITY_DN106_c0_g1
ATCATGTTGACTTGAAAGATAAGGAAGCAGAAAAAGAAGAATCTCCTACGGATATGAAAGAGATCATGAGTACCGGTGCTATGTCTGCTAATGTTTACAAGCAATATTTCAAAGCCGGAGGCAAGTGGTACATCTATGTTCCGGTTATTTCGATGTTTCTTATAACTCAGATCTGTGCTTCTTCGGCCGATTACTTCATAACATTCTGGTGAGATTCTTTTCATTACTGTGAGTATCAAGATCGAACAATTCGAATAATTATAATATAAGTTCTTTCTGTTCTGTTCGAGTTGAATAGACAAAAGTTATTGGGGAGAAATTGAAGATTTTTTATCATGATTGCATCGTAATCGTTGTTATATGGCGAAAGTGGGAAATCTCAAAATAATTCTTTTCGTATCTTAGTAGTTGGAAAAAAATGATCTTCAAAATTTAATCTCTCCATTGAATACAAAATGAATTTATATCCCAATGACTTTTGGGATTCGTCATCCAGACGCTCAAAATAAAATTTTCCTACAACTGCTATGAAAAGTAGAGTATTCTTCATAGCTTACTCAATTTCAGAACTATGTATTGCTCATACTGTGAGAAATATTATTTCTCACGGCATTTTGCCCACACCTCGCTCGGTAGACCAATGAAATTGGGCTTTTGACTCGTTTCTATGGAAACGCAATAAATTGGCACATACTGTCAACGAAGGCCATTTTGATTTGAATCAAGTCCATTACTTGAATTATTGAAATTAGTGCGGTTGTAGGAACCTTTTCCTAGTGTGCAACATGTGGAGAAAGTCGTTTTTTTGCTCGTGTGTTTGCGGCACTCGCCTTTCAGGCTCGTGCCACGAAATTCCACACTCGCGAGAAAAGTTGGACTTTCCCCACTAGTTGCACAATATACTATTTTTGATCCAGGCTCTTTTCAAGGAGTTATTCCATAGGATCTTTTAAAATGGGTCACCCTGTGTAAATATATTTTTATAAACTTATGTATTTCCTGATTTGCTCATTTGAAAAATGAAAACTGTGTTTTTTTTGTTTTCTCTGCTTAAACTTGCTATTTAAGATTCTTCAAATTAATTCTCTTGTAGTTTAATACAGAAAAATTTATTTTACACCAACATTTAAGTGATATTCATAATACTCAATTCATCTTATACTCCAGTTCATTTCAGCAGGTTTTTGTAGGATATACGGTTTTCTAAGATATTTAAACCTAGTTTTACTTTTTAGTATTGCATGTTGTGTAGTTTTGCTGTCTTTCAATAAAAACTCTCCCTCA
>TRINITY_DN84_c0_g1
TATGTGAGGACGTTTGGCTCGAAAATTATGTGATTTAATTGTCACAGGAAATTAATTTGTCATTACTTTTTTCAGAAAATTTTGATGTGATTGTCGAATCGATGTCTTAATTTGTTTGTGGGGTGGGCCAAATTCATGCGTAATTAGTCTTAGGTCAACTATATCTCTAATTTTGTGAGACTTGTGTGAAATCACTCGAAAAAATGGTTATGAATCAATTTGTTACCACTTATAGGAAAGATTACTTGTGGCCGTATGTGAGGACGTTTGGCTCGAAGCCATCTCCTGATCATCTATACATGAGTAGAAATCTGGGACAAAATTGTTAAATCAGAAACAAATTTGAATTTCAGAATTATGTGATTTAATTGTCACAAGTGATTTTTTCGCACATTTTAAGGCTAAGAGTTCATAAGAACATGTGGTCGGAAAATATCCCATTTTTTTCATAGGCCATCTCCTGATCATCTATACACCATCTCCTGATCATCTATACAAAGCTCAGTATCGTGACCAGAAAACATGCGATTGCAACGCTCTACCTCCAATACATCCATCGAATGAACAGAAACAGGTATTGGGTCCAAACGCCCTCAAAGAAGAAGCATGGAGTCGATTAGGCCCCATGGGGCCTTTGTTGGATCCTAAAATCTATCCCGCAAGAGTGGGGGCGCCCCCAGAATCCCAGATCAGTCGATTCAACCAACCCAACGTTTTCCTTCAGAAGCTCCAAGAAAAGTATCCGTTTATTTACGAATGCTTGAGAAATGCTCCTCCTGACGATTTGATATCTAGAATCAATAGAGATCGTTTGCGAACAACTTATGAGGTTGACTTTTGTCGGATGAGAGAATATCCCGATGCTTCATACGATGAGCTACTTAGAACTGCTGGAGTGTCTGGTGCGCCTCCATGTCCGGAACCTGTGACTTTACCGGGTGACCCTTGTAGGCCAAGAACCTGTGACTCTACCGGGTGACCCTTGTAGGCCAGGCCAGAGGAATGTAGCTTACAGGCCGGCAGTTATAAGTCAAATGGGATACTGCAAGGGTTCAGGAGGAGGTGGCGGTGGATTGGGCGGAGAGGTCACAGAACATTGCATTGGAACTTGTCATGGACCTCTTGCTGCTACGACAAACGGAATTTCAGAATATATGGACAATGTTTCTAAACTGGGTGGAATAATCATGAAAGAAAAAATACATTTCCCGAAAGAACAAAAAAACTTCTGAAAAATTCTAAAGAAATACAATTTTTTGTATTTTATCTTATAGAAAATTCAACATTAGACGCTATTATGAATTCAAATCAGATAAATCATATTCATAATGTTCATTTTGTAAAAACCGTACTCATAATAAAACATCACTCACTCATTGAGGTGAAAGACATAGCACAATGGAACCCCTTTGAGAAAGAATGTGAAGAAAAACAAAAAGATCCTGTGGTAGAAAGATGGGGTCAAATGCTTTTCAGGGATACAATGCATTGGCACAGTCCGTTTCCTTCAGGAAGAAGTGTTAAAGACAAGAAAATACCTATGAGCAAGTCTTGTTTTTGAATTATCCAGGAGATATAGTAGGACTTAAAAAAAAAATAGATGTTTTTTGTTATAATAGATAAATTTGGTGACAATATAGCCGATCA
>TRINITY_DN164_c0_g1
GTCCTCAAACCATCGAATCTACCGCAAGCACAACTTATGAAAAATGTTTTTCATATTCACGAGAGCGTTCTATCAGAAATGGCTGGAGTTCCTTTGGAAATAATGGAACAACCGTGCACTAAAGAGAAGTACTGTTATCCTATAGCTGAGTCGAATTCAATGACGATTACAGAAAAGAATCAAGAATATGATGAAGACAGCATAAGGAAGTACATGTCTGAAGTGCTGCAGGTATCAGAGCAGATCAAAGCAGATGTGAAAGAATTGAAGCCAGATTTGACGCCAACTCCAGAAGGACAAGCCGTGACACTTGTTCTTATGGGTGACAAGGACATTGAAAAAACTCCCATTGATATCACAAATACAGATATATCAAAAAG
>TRINITY_DN131_c0_g1
GTAGGTGTAAAGGATAGGCAGGATGAAAATATTAGAAGGTGTTGATTGATAGTCCAATTCTGAGTTCTCAGTATTTTTTACATTTTACAAAGACTGAATCAATTTGCTTTTATAGAAAAGCATCTCATTTCCTTCAATATTTTAGTGTTTCTCCAAGTATTTTCGTAGAACGGCATTAATATTTGTATGCAATAAGGCTATCAACCGATGTGTA
>TRINITY_DN28_c0_g2
CGCGACATGCTAAGTTTTTGCAATATGAGGAGTTACATGTCAATCCTACCGTCTTTGCAAAGGTAAAGTAAAGTTTACATATTTTAACAATTGATGCTTGCATTTGAGTTGGCACATCTCGCCTGATTAATATTTTATATCAAGTTGTAGTACAATTATATACTCATTCACAGAATAATCAATCATGTTTTACCCCCCAATCCTCACCCTTCCCCATCTCCACCACCCCGACCAAGCTGCATTGCAGATCTTTTGAAGTCTTAGTCCATGCTCTATTTTGCCTTGTTAAATAAATTCTCAAATCGAACTGTATTTATGAGGCGGATAAGATCTTTCGTGTGTATTCTTTCGAACTATCGGATCATTTTACTCATTAGTTAAATTTGTATTTATTCCAAGTTACCCCGATGTCCGGGGTTGTATTTGTTTCTAGCATATTCATCTTCTTCACAATCTACTAACAACGAAATAGCGGGGAACACACATACTAG
>TRINITY_DN22_c0_g1
GTGGTTACGTGATTCCACAACGTGAGGGCTATAGGTCTGTGCAACCACCGTGGGAACTTCGGCATCGACGTATTTGTGTACGATTTTCTTGTTAAGTACCTCTACCTTCTTTTGAACTTGAATAATTTGTCCAGGTACTTCCACTTCTTTCGTCACCACTTTGTAATCAACAACGGGGACATAAGTCAACACATCACGGGGAACTTCAACCACCTTTTTCACGGGTACAGGCTTGATCTTCGCTACGTATTCAGGTACCACTACTTCTTTCTCCACAATCTTGTACCGGGGTACTTCTACGATTTTCTCCTTTTGTACATACTCAACTCGGGGCACTTCCCTGATACGCTCTTTATATTGAACTACCGGTCGTTTTACTATAACCTCTTGCTCCACAGGAACTGGGACGTATTTGATCCTTTCCTCACTCATATTTAATTATTACTAACTATCATTAACCCTTTCCGCGCCATCACCCACACACACACACATCTGTCCTTCATGAGTTCACTCATCTCCCCTTATAATCAAACAACTGTG
>TRINITY_DN28_c0_g1
TATGAACTACGAATGAAACCATCGTTTTCTTGTTGTTTCTACCGATAGTTTTGAAGCTGAAAAATGTAAAGTCCTCTCTTTTTCTTACGAATAACAAATATAAAAGTCGAGTACCTTAGCATGTCGCGAGTTCGTTCAGGTCAAATGATATGACGAGAGAAGTGAATCTGTCGGTTGAAGTTGCAGAAACGAACGGAGAGAAAGAGAGCAAGAGGGAAAACACACCAGTGAGAGAAGACCCCGGGCAATCCCCGTGCGGTCTCCCCTCAAAACCAAAACATACTATTTTTTTTATTATGAATGACCTGCCATGCAAGCGCACCTGTCATGGCAAAGGCCGGATGACAAAGAGCTACCAGAATTTATCCTCCTCGAAAAAAGGAGGCTAAATTCCGATATCTTTTACATCCACAATCACTCATCTACTCTTTCTGATGCTTTCATAATTATGATACAAATACAGCTTCCATCGTATATTTGCCCACAGCGCTGCTACATCGAACATACGAACAGATCCCTGCCGAAATATTCAACATCGACAGCAACCAGCCGCTTCAACTCCAACAACGACACTATCCGTTATTGCCTCCATCAATATCCACTGCCGACTCTGATTTCATACCTGTTCGAATAAATCGAAACGCCTTTCGTTGCATAACAATAAAGCAAATTACCATAATCGAAAACCAAACCCTGGATTGGCTCGTACTGGAACGACAATCTCTCAATCGCAGTGAATACGGAAATAGCACACGAAAACAAAAGAAAGAACGATATAACAATCCAATAATCGTCGTCGCCTCCATCAATATCCACTGCCG
>TRINITY_DN134_c0_g1
CGGCGCTTGTGCCGCACCCATTTTGCTAAATGCCATTTGCCGTTCATAGGAAGCAAGATCGGCTGCAGACAGACCTGGCATGTGTCCCACATTCGGTGGAGGAAGAGGGGTAGAATTTGTCCCTGGCGGGGTTGGCTTGCTACCCCATGAACACTTAATTGGTTTGCCACAGACAACTCTAGCATTGCCTGTTTGGATGGCTAAAGCTGCTTCAGCATGAGTGCTATATCTCACAAACCCAAAACCTTTATCCCGTTGTACCCTAACATCTTCAATTGTCCCGGCACCAAGGGCATGAAAATAACGGTGGAGATCAACTGAAGTAACCTCAGGAGCAAGATTTCCCACATAGACGGTTGTGTATTGAGGATTGTTCTCAGGTGCGTCCTCATTGGATTTCTCCTGACCACCATCTGAAGTTCCAGATGTAAGCTCTACAACACTTCTGGAATCTGAACTCTGTTTGTCATCGCCAGAATTCGCACCTTTTGTGGCCCAATTACACCTAATCTGTCGACTCCCAAGCCACTTTCCATTTATGTCATTAATTGCACTTTGAGCGTCCTGCTCGTTCCGAAAAGCAACAAAACCATAACCCCTCGAACGTCCAGTTTTCTGGTCCCACATAACCCTTGCATCCGAACAACTGGGGTAAACAGAAAAGCATGCAAACAATGTAGCATCAGTAACCTCAGGGCTGAGATCACCAACAAATATATTAAAATGACCAGATGTGTCTTCCCTCTGACTACTTGCATATGCCCAATTAACTTTTATAGGTTGTCCAAACAAG
>TRINITY_DN76_c0_g2
GGTGAATATATGTTTATTTATTTACACTAATTGATTCCAATTTTCTAGTTAATGTACAAAATCAATGTACCTATTCGATTACCAAATATTTCGATCTGCCATTTTTCAATTATTGATTCACTGAGATTTCAAAGTCTAGTTGCTTCTGAACTTGTAGATACTTGTTTTAATGTTGAATTTTTAACACTATAATATGTATTTGGATCCTCTGATGTACTAGAATTCCGTTTTGGACTCTTCTTTGTGTATGAGGAGTGTAGGAAAAATCTTGTTTCAGTACCAGGTGATAGAGGGTTCAGAGAGTCACAAGAATTGTTTGAATCGGCGTATTTTTGGTAAGATAATAAACTTTCTGTAGATCTATTTGTGTTAAAATACCTTCTTTGTGTATGAGGAGTGTACTGAGGAGTTTGTGCTGAGCAGAAATTTGTTTTTTCCATTCTCGCACATTGTGTTCCTTGAGATTTCTTACTAGAATTCGGTCTTGTGCTTCCTGCCTTATTCTTACTAACGGAATCAATGTAACCGTATCCTCCAAAGCCATAACCCCCGAATGCTTTAGTCTCTAAACTATCCCAGGACTTGGGTTTGACAACATTATATTGCACATAGACAGTTTCATTGGCATGAGGATAATTTTGACACTCGTATTTAAATTTACCACTAGAATTTTTTGAAGGTTTAATATCACAGGAACCATTCCAGTATAGTGTATCTGTGCTAAGAGAAGTGGTATAGCTTCCAGAACTTTCCCCAGTTGTAGTTGGTGCAATGGCACTTTGCTCGCTGGATGTGAATGAATGTAAACTACATTGACTTACAAGACCAGGTCCAATATGAAAATTTTTTCTAGGTACGTAAAACGTTTGACTAGAAGGTGACACTTGAGATGTTTGAGAATGCGGTCTAGATCTTGGAGGCCTTTGGTTTTGTGGCGGTAAATCACATTGTGTTTCTTCGCTCTTAGAATCCCTCCGCTTCATTGAATCCTTATGATGTTTTGAGCGTCTTCTGTTGGAAGGTACACAGTGAGGGTTACAACAAGGACTTGCTAGATCATAGGCATCCAAACTAACGTTGTCTGAGTTGTTGGGTACTTGAACGCAAGAATTGCATAGATTTCCAGAGTAGACATGACAAGTATTCTTTTTCTCTTTTTCCATACAAAATTTCGTTTGATTACCTTTATTTTGTTTAGTCACCGGAGTTTCACTGGGCGTTTTGACTAGGAGATGATGTTCATTAATGCTTTTTCCATCATCGAAAGCTAAAAGATATTCACTACTATTGTTTGTGGGCTGTAAAATATAGCCATAATGGGGGTCTAAATAACGGTATGCTAAAATCAAAGAAGAATTTCGTTGTTTTTCCGGTAACTTGGCCACATCTTCAGTTGATACGGTGGTTCTACAGTAAGGATAAGGAGTTTGAGTCGGAGATTCTGGATCTCCAGATGAGTTTTGTTGTGAGTATTTTTTTCTAGCTGGAAGACTGTGAGTTCTCCATTTTCCTTCAATTAATTGCCTTTCTTGTGTACACAGTTTCTCCAGTTCCAACATTTTTCCTTGCAGAGTCCTCTGTAGTTGTATGTAGCGTATATGAAGTTCAACCCAGACATAAGCTTTGGGGGGTTTCTAACACAGTCTTCGAATAAGACGACCATTCTCATTCTTGAATCACAACTCTTAATGAAATTGACTAATGTCTTATGGTCCGCCTTTTCCATGTCGGTACCGTTGATTGACAATATAACGTCACCTTCACGCATTCCAGCGCGATACGCAGAACCATCATAGTCGACATAGTCCACATAAGTGATCATTTCGATTTCTTGCTCTTTCTTGTAATGAATTCCGTAGCTTTGCAAGGTGAAGCCGTAGGATCCGTTCTTTTTTTCAACGATTATAGTACGTCTTCTTCGATCTTCTTCCGGCTTTGTCAGGGTAACTCGATCAGGTTGCACCCTCTCCAGAATTTGTGATGCCGATGAAGTACAGTCATCGTCACTCTGCTCAATTAATGATTGATTCTGTCGTCTCATTTTTCAGAGAAAACTGTATTCTTCAGGTAACGCACTCGAACTCATAAGGCAAACGATATAACAAGAAAATTATTGTCTCCATTTTCTAACAGCTGTTTTGACATAAATGCTCGATAGTGTTATGCTGCGTTTTGAGGAAGTTTTCTAGAAACAAATTCGAATTTATATCTACAATTCATTTTGATTTATATATATAATGGTGCAGCCCAGTGGCGTACCCAGACATTATCAAAAACAGGTCGGTATATAATGGTGTAGCCCAGTGGCGTACCCAGACATAAGCTTTGGGGGGTGGGATAAAGTAAAAAAAAATTTGGTTATTCGTTTCCGATGTCCTTTGAATTTACAGATACTTCATGAGATTGTCGAAAAGTGAGCTGTTATATTCAGACGCAAAAAACTTCAAGATTCGCCTGCATAAATTTGCCTTTTTTTGAGGAAGTTTTCTAAAAAAGGTTGCTTATTCATTGTTACTTCGTGAAGATTCGCCTGTATAAATTTTGCTTTTTTTGAGGAAGTTTTCGAAAAAGTTTGCTTATTCATTGTTACTTCGTCTTTTTATCAAAGAATGTCTTTAGTTGTGTTAAATTTTAACTATTATTCGACAATTATTCTTCACAATTGAATTGACAAACTACTTCAAAAAAAAC
>TRINITY_DN76_c0_g1
CCCCTCCTCTGATCTAACTATATGAAATAATACATATATAGGTATATATAGATATTTAATTCAAATAGTCACTTATTTTATAGACAAACATACCACTGACTAGATTTATATTATGGAAATTGTTTTCTATAAGAAGTCTATACTCATGTGAGAAATCAAAGATCAGTTTTGATTTTTATTTAAATAGTCACTTATAGACAAATATACCACTGACTAGATTTATATTTTGGAAAATGTTTTCTATAAGAAATCTATACTCAGGTGAGAAATCAAAGATCAGTTTTTAGAAATCTCTGATAGATCAGAGTTCCTAGTCAATGCTCCCATAAGGTAAAGCACACAAGATCATCTACAGCCAGGAGTAATGTTTAACCTAATCCCATATTGCGTCAGGTTTATGTTTAATCTAATCCCATATTGCGTCAGGTTCATAAACAAGATCATCATCACACAATGTAGACAACCCTGCCCTAAACGGGAGAGTATTTGGATCACGATACATCCGTAATTCATATTCGGACAGAGTTTTGAGTAATTGGATCACGATACATCCTTAATTCATATTCGGACAGAGTTTCGTTGATATTGACAGAGAAAAGAGTCATTGTGGACTTTTCACTTTTGTGACTCTCAGAGGGCATTGTCCCAGTATCAGTGGTTCTGGGTATTGCTGAGATGGGGGGATGAGGCGACTTCCTTGTGGGTGCTCCTCCTCCATTAAACCGACGTGCTAGTATGTATGCTCCTCCTCTATTAAACCGACGTGCTAGTATGTATCCTGTAGCAAATCCGGCTGTACACCCAATAAAAAGACGTATTAATTCTCTAATCATGTGATGATCCATCGTTTAATATGTTGAGGTACGTACTAATTCTCTAATCATGTGATTATCCATCGTTTAATATGTTGAGGGGCGTAACGGAAGATAACAATAACTAGAATTTGTTTCTTTCTGTGTCAGGACAGGTTATTTGTTTGTTTGGGCTGTGCTGCTTCTATTGTTAACTTTTATCTACTGCTTCTATTGTTAACTTTTATTCGACAATTATTCTTCACAATTGAATTGACAAACTACTTCAAAAAAAAC
>TRINITY_DN174_c0_g1
TGATCATGAAGACTTTTGCCGGTTTAGTAGTAATCTCCATTGCCATATATTATGTGAGTTTTGATATGACTTTTTTCGTTTTCGAAAGGATGAAAACAGTAACGAAACTTCGATCGAAAATCTCAATGATGCATTTAATGGAGTTTTGATAAACAAGAGTTCAATTTAATAAATGTTGATATCATTACTGTTTTGATAGCTTTTTGAAGGTTTGTGTTGATAATTATATTAATGTTATTTATCGGGAGAGAGATATTTGGAAGGATGTTCAAAAGAAGTTTGGATAATATCCAACGAAAAAAATTTAGAACTCTGAATAATGTTTTTGTTTTGAAAAGTG
>TRINITY_DN107_c0_g1
AACAAAGATTGTCATGCTCTTTAAAATTTTGTTGAAATATAAATCGTATATTGTATATATCTTTAATAATGAATAAAAAATAACCGATATCAACCAAAAAAAATAACCGATATCAACCAAATTCAATAACCGATATCAACCAAATTCTCAGATCTCATTTTTCCAGAAATGGCAATTCCTCTCTTTGAAGAATTTGGGAGATCTCTCTTTGAAGAATTTGGGAGAAATTTCTTTGAAGAATTTGGGAGAAATGAATAATCAAAATGTGAGCGTTATTATCAGTCTTTCAAGAAAGTTATCCATGCTTATAGTCCATGTAGACGATGGAATTGGAATATTCAGTATAGTTATAATAAACAAACTGAAAACTGACTTTTGGCTCTGGGTTTTACTCAGAATTGAATTAAACAGGGCAATTTATGCCCTATATAGTAAATAAAATTCTGAATTTCTTGAAGAAAGAAAATTTCGAGCAGATTAAATCAGATAAGTGTGTTTTTAAATATATGGACGCTAATAAAATTCTAATAATTGCAGTCCATGTAGACGATGGAATTGATTTTGGAGATGACAAAGAAATGATGGAAGACTTGATATGAAGAGGCTGAACTTTGAATTTGAGGTTAAAATGGATAAAATTCCAAAATGTTACCTAGGAATGAATTTAATACTAAATGAAGAAGAAATATGCATAAGTCAAGAAGGTTATATCAATCAGGTAATGAAGAAATACTATATGGAAATGTCAAAACCAATTAATACACCGATAATTGATCAACGGAATATAAAGTGCACTGAAGACATGAAATGTATCGATTTTCCATACAGAGAAGCTGTGGGCAGTCTACTCTATCTAAGTTGCAAGACACGTCCAGATATAAGTTTTGCTGTAAATTTCTAAAGCAGAGCAGTAACACAACCGACCCAAAAAGACTATACGAATATAAAAAGAACACTTCGATACTTGAATGGAACAGTGAAAAGGAGACTCAAGTATACAGCAGATACAGAGGAAATGATTTTAAATGTTTTTTGTGATTCTGATTTTGGAGAAGATATGAAAGATAGAATAAGTACCAGTGGCTATGTAATGTTTTTATCAGATGCACCCATTGAATGGAGCACAAAGAAACAATCCGTTGTAGCACAATCATCGACAGAAGCAGAATATATAGCTGCGGCACACTGTTGTAAGCAAATGAAAGCTATGACGAATTTCATTGAAGAGATACCGAATGGAAAAATTGAGGTGAGATTGTATATAGACAATCAAAGTACGATAAAGATGATCAAAAATGGACAATTGTCAAGACTGAGCAATCACATCGATATTAAATATCATTTTGTCCATGATGAATATACCAAAGACTGGTTCAAGATAATATACTGTCCTACGGAGAACAATTCAGCGGACCTGATGACAAAATCCCTGAATGCCACTAAGTTTGAAAAATTTGCTAGTGTAATGACCAAATATTTTTAGATCGTTAAAATATTTCTTTCATTTTAATACTTGTTTAGATCGTAAATTTTTATGATTATTAAATATTTGCACTCTTAGAGGGGTGTGTTGCAATAAATAAGAATGCAAATATTATATTCTATGGTTGAAATAATTCTGTGGACATATAGGTTGTGAATGACAGTTGATTTTAATGTAAAATGGTGGCAATATAAAAGGCTCATGAATTGTGCAATTTTTAATATATCAATACCACAGAATAGAGAGGTATTACAGACGCGCTGCAGTCTTTCAAGAAAGTTATTCATGCTTATAGAGACATGTATGATGCATGTTTGTAAAAAATTTTTAGAGAATATTGAATAATAATATAATCCCAACATTAAGATTTTAAATTAGCACATTTCTTCTTTATAGAGACATGTATGATGCATAAGTCCAAATTTAATTGATGATTGGGTGGGAAAAATTGACAAAAAAAGTTTATGTTTGTTAGTTAAGTTGTAATCCTTTTTATGGTCCTTTTTTTTGTTTATTTAATAGTTACAATAGACAATTATTAGCATATTTTTCTCTGAATTTCAACTTTGAAAGAAAATTTGTCATTTTATGTCTTGCCGATGAAAATGTTTTATGTCTTGCCGATGAAAATATTGATATTCTTGTAAGTCAATTCAAAATGAATGATAGATATATTTTAAGGGCTATCAATAGATATATTTTAAGGGCTATCATTCCATTGGATATTTACTTGTGAGCCCTGAAATAAAGAAATTGCATTCAAAATGAAGTTACATTTATTCAAGGCCCCAAAATGAAGTTACATTTATTCAATTGACTCATTAATAGAAATATTACCTGAAATAAAGAAATTGCATCTACCTTTCGGATACCCATATCTGAAATAAAGAAATTGCATTCAATGTTTATTTTCAGTTTTGACAAATATTGAATTTACATAATCGTTCGATAAGGAATTTACATAATCGTTCGATAAGATCCATGAAAAGACCTACAGTGAGATTTATGAAAAGACCTACAGTGAGATTTTTGTTTTAGGAATATTCAGTAGTATAGGAATATTCAGTATAGCTGTAATAAACAAACTGAAAAGAGGCAGAATGAATAATAGATCTACCTTTCGGATACCCATGGCTGATGTTGCATCATAAGTAATCGTATATCTGAGAAATCAGGTTATAAGAAGTCCCTCATTTCCAAGGTTTATCAATACATTTTTCAGTTGAGCAGCAAATTATTCTTCTATTCCATATTTTGTGAAGAAATACAATATAATTGCAACAATTTGAAGGACCTATTGGAAATTCCTGACGAACTAAGGAG
>TRINITY_DN181_c0_g1
GGTAAAATCAGGTTCTTATGTAAGTATCTTGCTGCCCTCATTATTCATTCTAGGAAACATGTTCATAGTGATTATTAAGATGTACCTATTTTAGATGAAGAATTTATATTTCATTGAAAAGTCTCTCTATATATTTTTCACATTTTCCTAAATATTTTGACAGTTTCAAAAATGCGTCAAACTCTCATGCTGCAACTCAAAAAAAATCCTGAAAATTGCAATAAATATCTACTGCTTGGTTCCTTACAAACTGTTTTGCCATATATTTCAGATAGAAGAAATGAGGAAGGAATTATTTCAGCTTGCAAGAGGTAATCCAAATGTGTA
>TRINITY_DN86_c0_g1
GTCTATGGTCTCCAATATTTTTATAAATATAAACAATAACAAATGTTTTCTGATTATGAAGATCTTACCCCGAAAGTTTTTAATGAAAATATTTATCTCCTTGATCCTCCTGCTTGTTTATTGCGAATATTGGATTTACTATATTGTCACAATCCAGTGTAATTGGCCAATACTTGATCCAATAAATGAGGATACAAAAGTTGAAAAAACTTTGGAAGATCCACTTAAAATTATGGTCATTGCTGATCCACATCTCCTGGGTCCGAGAAAAGGACATTGGTTTGATAAATTACGTAGGGAGTGGCAAATGCGTAGAGCCTTCCAAACCGCGGTCACTCTACTACAACCTGAAGTAGTTTTCATATTAGGAGACATTTTAGATGAAGGCTTTTATTGCAGCTCACAAGAACTGAAGACATACACCCGTAGGTTTCAAGAAATATTTTCACTTCCAGATCATATAAAACTGTATATGGTGCCTGGAAACCATGATATAGGATTTCATTACGAGATACATCCATATAGAATATATGAATTTGCCAAAGCTTTCAATGTATCAGGTGTACAATTCATTACAGTTAGGGGAAATCATTTTGTTCTTGTTAATAGTATTGCTTTAGCAGGTGATGGATGTTTTTTATGTAAGAATGCTGAATTGCATCTTAACAAAGTGGAAAAAATGTTAAAATGTTCCAGAACTACCAATAATGGTGAATGTGATGAAAACTCTGAACTTGAAGTATTTAGTAAACCAATTTTGATGCAGCATTTCCCTCTATATAGGCAGTCTGACATGGAATGTAAGTAAATCGATTAACACAAATAAAAACTTGTTCTATGGAAACTTTATGAAGTACTTTGTCTGTTACTAAAAATTTACAAATATTAGACCTAACGGAAACTAAAAAATTTGATAAGGGTAAAGATGCATTTCAGTCAAATGACCTGTGACCCTTTGAGTCTATTTCCACAGATTACACACAGATTAGTCTGTGCTATTTCAATCATTTATGTTAAAATGGGTGCTGAGTTGTCAGATGGGTGAGTTGATCCTGTACAGTCTGACATGGAATGTAACGATTTGGATTCTGCCCCTATGCCTGTTAAACAAGAAAAATTCAAGGAAAACTATGACTGCCTGAGCCAAGAAGCAACTTATCACCTTTTAAACCAAATAAAGCCGCGTCTTTCATTATCTGGTCATACACATCATGGTTGCACAAGAAAACTTCCATTTGATGGTGGCTTGGAGATCACCATTCCAAGTTTCAGCTGGCGCAATAAAAACAACCCAACAATAGGATTGGTAATATTATATTCTTCATATTATTTTTAATTTGAATAATTTCTCTAATTCTTGACCTTATAAAAATTTTAGGGTGTATTCACTCCTAACAATTGTGTATTCACTCCTAACAATTACGCCTTCACAAAATGCCCTATACCGAAGGAATCGACAGTTATTTTGTTGTATATTCTGGGTGTAGTTTCTATTCTTGCATGGATCCAGTATATGTCGTTTAAATCGAGAAGAAGGCAGCGTATCAAATAACAATCATTCATATCTTGTTTAAAAATGAACTGAATCTCTGAAGCGCTTAATACTTGAATATCATAGATGTATCATTGTGAATAAATATAAATTAGAGAACTCTCAAATAGTTGTAGTATTGATATCTGTTTAGTGTGTTAATATGTGCTAAATGTTTTGTATTTGAAGACCAGTTGGGAAGTATGTGACATCACAGGAGGATGATTAAATTTTTTATTCTTCTAATAAACATATGCATGTACTAACAGTTATTTTGTTGTATATTCTGGGTGTAGTTTCTATTCTTGCATGGATCCAGTATATGTCGTTTAAATCGAGAAGAAGGCAGCGTATCAAAT
>TRINITY_DN170_c0_g1
ATTTTTTTGAAACTGTCTACGGCTCTCTATAGTAAAGATATAGTATAGACGTAGTTAAATTGTCGTGTTAACATAGTAGATACTTAATACTAAAACTATGTAAATAGCTGAAAACAAGTACCCAAGAAAGAAATGAAAATTCCAAAAGTAAAAATTTCAGATACAACATTCTCGCTAAACACAGCAAAGTTCTTAAAAGTGGATAAGTACTTATTTGTTATTTGTATTTTCTTAATCAGTTGGAAGCGCA
>TRINITY_DN122_c0_g1
GGTTTTTAAAACTTTTCAATACTAATTTATTGAAACGGCAAAATTATTATTCTAGCAGTCATAGCCATCTCTATTATTTTAACTTAGGCGAAGGTAATGTAATTGTAGCTGAAACTCCGAAATTGTCATTTAGGTATAGGGAACTTTACATGAAAAATATTCAGAATATTCGACCTGAAGCGAATGCTCTAATTCTTTCTTGTCGTTACGCCACTGGTGGCGCAGTTGAAAACTTATGTATTTGATATTAAAACGTTCCCCGACATTTTTTGAAATTTTTCGATGGAATTGAAGGCCTTCTTGCACCCAAAATCTGACGGGCGCAATCGATTCAACAAGAAAAACTACTAAGGACCTGAGTATCAGAATACGATTTTTGCCTCCGGATCTGAATGAACGCCACCGGATTTTTGAACAAAAAACACTGCATAAGGGCCAAAAAAGGACGAAAAAATTTTGGTTTTAAGCCAATTCTGA
>TRINITY_DN20_c0_g1
GAGAAATCGAGGATATGTTAGAAGACATATCGCCGAACGACTTAGAAATTTGCGATAAAGAGGTGCAAATCGCGAAAATCAGCCACAGAATACCTGATGGCTTTTGTTCTATAGATAGAAATGTTTTGCTCCAGGAAAATCGGCAAGAAAACACCAATATTGTCCAATGCACATTATTCAATCCGCTCTCACCCAACATCTCGACTCTTCTTGATACCGGTGATCTTACTCATAATTTGCA
>TRINITY_DN93_c0_g2
GTCAGCATGGTCTTATGAAATATTTGTGGCACTCAACTATGTGACTTAGTTCAATATTAATTAGTTTCAAATAATTATTATTGATGTTGTGTTTTACCTGTTCCAAAATCTTCAGTTTGTGTTTTTCTAATGTATGTTGATATGTGTATCAAATATGATATAATGATGTAATGGAGAATAAGTCTATTATAATTCAATAATTTATATCCTATAGATCCTAACAGGTAGCGGAGATTCCACCTG
>TRINITY_DN151_c0_g1
TCAAGCTTGAAATGCCGCCCTTGCATTTTGCCGCCCTAGGAGATCGCCTACCCTGCCTATACCCCCTAGCTTCGGCCCTGCCATTACCTCCTAAAAACATGCCCAAATCTTTAACCCTCCAAGTGGCAGGTTCTAGCAGAACGAGCAACACGAGTAGAGAACCAGAGCAGCCACCCAGCCTAGCAAAACGTGACACAAGAGGCCGAGAAAGAAGCAAGAACATGCCATTATTTGGCTGTAAATACGTGGTAGATTTATATTTAGATTTCATTAAGGAGGTTCCGTTTCACTGATACTTAATCAAATTGTGCCCCCCATCAGAGCTATTCTCTCCATAACGTGATCTACAGCTTGTCTTCCAGTTCCAGAGTTCTGATGAACTCCAATATCTGGGATAGCTCCAAGGAGGCTAATTCCTCACTTCTACAAGTTTCGTG
>TRINITY_DN166_c0_g1
TAGAAAAGGTGAGTTTCTTTCAATTCTTTTCTGTAATATCAATTTGTAGCAGTGCCTAATACCTTTCCATTATCTTTTTAATGCATGTAGTATTCATTCTATTTCAAATGAAAGATTACCTTTCAGGTTGATTTCATTATATGATAATTCAATTTACTTTGGAATAATACTCTTTGTTGACTTCCCATAAAGTTACATTCATGATATTAATTTAATTCAAATGCAAATATATGAGTGGGAGTATCTACCGATATATTCAAATGATGAAGGCTGCTTCCTTAAATGTTATTATTTCCAGGACATTGCTGCATATATAAAGAA
>TRINITY_DN56_c0_g1
GTGAAGAGTGGAGGCAGTGTATCAAGGAGGATTTGAATAAATTAGATCTCAAAAAGTTTGTCAGATTGATGAATGGGTTGGATGGTCAGAATGAGTTAGATTTCAATGCACGAAGAGCAGATCATTTGTCCCATTTTATATTAAGATTAGCATATTGCCGTTCTGAAGAATTAAGAAGGTGGTTCATCAACAGAGAGTTAGAGTGGTTTAGGTTACGTTTTATGATTCAGAACCAAAATACACTAAACAGATTTCTGGAAAGTAATAATTTAATTTATATTCCCATTTCTGAAGAAGAAAAAAATGCAATTTTCAATGAATTGATGATGTCCACAGCTAACATGTCTGATATCAATATAAAATCTAGCAATTTTTTCAAAGTACCTTTTGTTGAAGTATGTGCCCTTATCAAAAATAGAAGGGTATTTGTCAAGATGGGATACGCATATATTCCAACAAGTGAACTTATAGTTTGTGTTCAAGCCAAATTTCGAGCTAACTTGAGTGAGGCGCTGAACATTGCTAGTCACCGACTACCATCTTTGGATGATGACAGAATCAACACCTTTTTGCTCAACCTGAACAATTCTTACACTGGCAAAGATTATAGTTCATCAAATTCAGAGAAAAAAGAAATGGATCCAGCTGATTTAGATCTTAACTCAAAGAAGCACTATCCAATGTGCATGAGGCATATCCATGAAACACTTAGATCTACTCACCACTTAAAGCACAAATGCAGATTACAGTATGGTTTATTTTTAAAAGGTATAGGATTATCATTTGAAGATGCTATGGATTTTTGGAGAGATGAGTTCACTAAGCTCATGGATCATAACAAATTTGAAAAAAGCTATGCATACAATGTCAAACACTCCTATGGAAAAGTAGGAGGAATGGTCAATTACAGCCCTTATAGCTGCATTAAAATTATAATGGAATCTGTAGGAGTTGGTGATCATCATGGTTGTCCTTTCAAGCATTGGGATTCGCATCTAGTAAAGCAGAAGCTGATGGACTATGGAGTTTCTGCAGAAGGTAACATCTACTGACTAGAAATTGAAGATAAACCTCAAATTTCTTTTTTTTTAATATGAACAATTGTTTCATCAGGTTTACTTTCCAATTCAGTTTGCGTGGATTATATTGCCATACAAAATGGAAAAGCACTGAAGTGACGTCAGGAGCTTTTGTTCCCTAGTTCAAATTTGTGTTTACGTAATTTTTCTCATAAAATTTTTTCAACCTTATCCTTAATTAAGATTTCTGAAAAAATCAGATGTCAATTGGTGCTGTAATGGAATTGGTGAAAAATGGTCATTTCCAGATAGCTTGTACAAAATATTTTGAATATACTCATTCAATGCAAGCACCATTATCTGTTATAAATCATCCAAACCAGTATTTCGAAGAGAGTATACAAATGTCAGGAGACAAGAAAAAAGCGTGACTTTGCTAAACTGCTTTGAATGATCAGTTTAGTTATTTTATTACTGTTCTTGGTTTGTGTAAATATATTTATAATTATCGG
>TRINITY_DN75_c0_g1
GTAATTTTAATAACTAAAATTCCACAACCATAACTTTTAGATCTAAATGTTTCTTGAAAGGAATAACTATATTTATATTTTTTAAATATAGAATCAGCCTGAATATTTTTAAGATGTTCTCAACAGCTCATTACAAAAATAGCTAACCACTAATTTAAACTTTGCTATCATATCACAACTGTTGAAATAAGAGAAAATAAATATAATAAATATCTTCATCAGCACATTACCTAACCTTATTCATGTTTACGAAATCAAAAAATTGTAAACATGTTCAAAAATACTTTCCGGATTGTTTAGATGTAGATGGTGAGTTCCCTCAATTTTGACCCTTGTTAATTGTGCGTTTTCAGCAATAGCATCTAGAACTTGGTCGTATAATACTTGATCGAACGGATACCCAGGGATTGCCCTGATATTCAACACTTTGCACCTAGTTCTCGAGGCATACTCAATAACTTGATCGCTAGTGAAAGAAGCAAGAAGGGAAAACTTCAATCTAGGGTCTCTGGTCAATCGGTAACAATTTGGTTTCTCCTCGTCTTTCACCATACCTCTACGTAGCATTATTTCCGTTGATTTTCTTGTTAGGGACCCCTTGTGCGCTTCAAACACTAAATCAACCATCTCATCGTATTCATACCTAGGTTGCTTCTTTGGATCATAGTTCTCGTATTTGAAAATGGTATCGATCGCTTTTGCTTGCAGATTTTTCAATATTTCCACATGAAAAACTGTAGGCGATGCGATATCAATCGAAATGTACCTATCAACTTCGTCCTCGTAAATAGAAGCGTAGAGAAATGAAATAGCACCTCCAAGAGAATGACCCATAAGTGTTATTTTTTTCCAGTTAAAAGTATTTACTATCCTTCGGATGAAGTGTACACCGTCCCAAAATAGATAATAAAATTGACCAGGTGATAAATGAGATGAAAATCCGTGTCCTGGAAGATCTATACAAAATATCGACATTCCTTTATCTCGTAACATAGGTGCTAGGGTATCAAATGTACCACTGTTATCTTGCCAACCATGCAAGGCTAAAATTGGCTGCTTCAACTTAGGTCCCCACCATTTTCCACTGATGTGTCCCCATGGCACTGGAATTCTGACTTCCTCGAAATTTAAATCAGGAACAGGGGCTGATTCTTGTGCATGACCATTTGCAAGTATTGTAGAAGCCATTGTTTCCTGAAAAATGCAATATCTACATCAGATCACTTCGTGAGTTTGTGAAGAATATACATTAATTGCTACTATGATTGATCAATAATCAAGTGTGCTCACTGTTTTATCATTATATTGATAAGAAAACAAGGAAAATGAGGAAACACATATAAAAAGCGATGAACTGGAAATTTCAACATTTGTCAAAAATTTTTTAAGTGATAGGTGCCTTAAAGACCTAATAATTTTACTCAAATACAAATTGTATACTTACCCCAGCATTATTGTAGAAGCCATTGTTTCCCCAGCAAACTACGAATCAATAAAAGTTCTTATTCGTTCATAAAGCTGAATAATGTTTGTATTAAATACAATGGTTTATGTATTCCATGAATAAAACATTGATTCTTTATTCAAGAACCGAAATAGCATTTTCCTGATTTTATAATAAACTCCCCTTCCAGTATCATTTCTTAAATGAACTTCTACAAAAAGAAAAACTCTGACAGACCAGAAAATTACATCATTGTTTAGGATTAGGTATCACGATTTTGCCACATGCAAATTCTTAGTGAGAGAATTATATTTGATCAGAGGTACCGCTTTTTGGCACATAATTCCCTCTCATTCTATTATGATAGTTGAAAAAGGATAACAAAAATTACGTATTTATTTTACTAACGCGTCAGTGGAAACAGTTATCAT
>TRINITY_DN52_c0_g1
AACCCCTACTTTCTTCTTCTTCCTCTTCCTCTTTCCATTTCTCTCCAGATCTCCCAATGGCGAAATCCCTCTCCCTTCTCCTCCTACTCCTCTCCATTCTCACCATTTCTTCTTCTTCTTCTTCTTCTTCCTCCTCTTCCCATTTCTCTCCAGATCTATCAATGGCGAAATCCGCCTCCCTTCTCCTACTACTCCTCTCCATTCTCACCATCTCCGCCTCCGCCTTCAACGGCGGCGCTTCCAACTTCATCAAATCCAAGTGCAGCGCGCCGCCGCCGCCCGCAACTCCGGAGCTTCCAATTTCATCAAATCCAAGTGCAGCGCCGCTACTTACCCTGACCTATGCGTCCAATCCCTCTCAAATTTCGCCTCCACAATCCAACAAAACCCTCGCCAATTAGTCCAAACCGCCCTAATCGTGAGCCTCTCACGCGCTCAATCCGCTCGATCTTTCGTCTGGAAACTGACGAAGTTCAGTGGACTGAAGCCCAGAGAGCACGCGGCCTTGAAGGACTGTATGGAGGAGGTCGGCGACACCGTAGATCGGCTGAACAAATCGGTGGAGGAACTGAAGCGCGTTAGCGGATCGAAGAAAAAGGACTTCCTATGGCACATTAGCAACGTTGAGACTTGGGTGAGTGCTGCTATGACCGACGAGAACACCTGCTCCGATGGATTTGCTGGCTCTGCACTGAATGGAAGAATTAAATCTTCGGTTAGGGGTCGCATTGTGGATGTTACTCGAGCGCTATGACCGACGAAAACACTTGCTCCGACGGATTTGCCGGTACCGCCCTGAATGGAAGAATTAAGTCTTCGGTTAGGGCTCGCATTGTGGATGTTACTCGAGTAATAAGCAATGCGTTGTCTCTGATTAATAAGTATGCTGAGACTCAAAGCTAAAGCTGTGATTTCAGGTTCTTCCAATTTCTACAAATCAAAGTTAGAAATGTGCTTTCAGGTTCTTCCAATTTCTACTCTGTTTCTGCGCTTGTGATGAACAATTTGAAGATGAATTAGATGAATCTGTTTTGGGTTTTTGATGTATATTAAGAGAGTTTTGTTTTTTTTTTTTTTTTTTCTTTCTTCCGTTAGTGTTTTGATGTGGGAAATGCAACCGTAACGATAAATAGTGCTCTCTGTTTTTGCCTATTATCTTTGTAATTGTA
>TRINITY_DN155_c0_g1
GTTCAATAAACATTTTTTGATTGTCAAATTTTGAAGTTTTCATTCGCGATTATAATAAAAGCTAAAATATGAAGCTTTTATTATAATCTCTCTCTTTCTTCTTCTTTAACCACGATAGTGGCTTCTATTATAATCGAGAATGAAAAATTAAATATCCGACAATCAAATATTTATAGAAATACAGACAACATGGATATACCTTCCGAATACTAAATCTGAACTTTCTCAGGTTGATTTGGATGGAATTGCTCAAAATAAACATAAAAATACCACTCCATTCCCACATTCGGATTCAG
>TRINITY_DN163_c0_g1
GTCAATGGTGACGGAGGAGCAGCCTGATGCAATGTTGATACCTATGGAATATTTTCTAATGGGATATGGCATGTATAGGCCATCTCATTTTAGCGTCAGCCCAAGAAGCCCTTTGAGCCCGTCTTGCATAGCTCCTGAGCTTCTGTCGCCAGAAAGTATGGGCTTGAAGTTGAAACCAATAAAAACAAGAATCTCCTTGCAAGTCTAGAACGACGGACGATAAAAG
>TRINITY_DN180_c0_g1
GGTGGGGGGTGTGATCATCACCAAAGCTACAAAGGGGGCGCGGAGAGATAGTATTTATTCTTTGGGAAAGCGTTGGATTAGTTTTTCTCGCTTTGGGCTTTTTATCCGGAGTTGGAGTGTGTGTGCGCCGGGAGTGGTGGTGGTGATGGCGGCCGGAGAGGAGGTGATGGATCGGTCGACGTCGGCCGAGGACGGGTACTGCAGCGCCGGCACGGACTCGCCGCGGGCGGAGTCCGTCGACGAGCAAGGGGCCGCCGAGGAGTCGTCGCCCCGGGGAGGGCAGAAGCG
>TRINITY_DN97_c0_g1
GTAGGAAACCGGTCATATGTCAATTCCGTCAGTCCGTCTTATGTGTTTTTATTTCGACCAGTCATCCCATATAACGAAGAAGCGAATATTTTTTGTTTTGTTTTAATACAAACTATTGAAAATGGCTCAGGCAGAAGTAGATAGAGAAAAAGTTCTCCAAGACTATCGAAAGAAACTTCTGGAGCACAAAGAAGTGGAATCTCGTTTAAAAGAAATGCGAGAACAGTGTAAAGATCTCACCAAACAGTATGACAAGTCTGAGAATGACTTAAAGGCGCTCCAAAGTATGGGACAAATTGTAGGTGAAGTGCTGAAGCAGCTTACAGAAGAAAAATTCATAGTTAAAGCAACAAATGGCCCCAGATATGTTGTTGGGAACGTGCTCTCTGCGACGAGATCCGCCAACAGTTCATTCAGACGCTCAAAGATGTAGAATTACAGCTCGTGGAAGACAAAATGGCCCCAGATATGTTGTTGGTTGTCGCAGACAACTAGACAAAGCGAAGTTGAAAGCAGGGACTAGAGTTGCTTTAGATATGACCACATTAACCATAATGAGGTACTTGCCAAGAGAAGTGGATCCATTAGTCTACAATATGAGCCACGAAGATCCTGGAGATGTTACTTATTCAGCAATTGGTGGATTATCAGATCAAATTAGAGAATTGAGGGAAGTTATTGAATTGCCTTTATTAAACCCAGAACTTTTTATGAGGGTAGGTATAACTCCACCTAAGGGTTGCCTTCTTTATGGTCCTCCAGGAACAGGAAAAACTTTATTGGCTAGAGCTGTAGCATCTCAACTTGATGCAAATTTCTTGAAAGTTGTATCTAGTGCAATTGTAGATAAGTATATTGGAGAATCTGCTAGATTAATTCGAGAAATGTTCAATTATGCAAAAGATCATCAGCCTTGTATTATATTTATGGATGAAATCGATGCAATTGGGGGTAGAAGATTTTCTGAAGGCACTTCTGCCGACAGAGAAATTCAACGTACTCTAATGGAGTTACTGAATCAGATGGATGGTTTTGACTCATTAGGACAGGTCAAAATGATTATGGCAACTAACAGACCTGACACACTGGATCCTGCTCTATTACGTCCAGGACGTCTAGATAGAAAAATAGAAATACCCCTTCCTAATGAACAAGCTCGTCTTGAAATATTGAAAATTCATGCTGGTCCTATTGCAAAACATGGGGAAATTGATTATGAGGCTATTGTCAAACTTTCAGACTCATTTAATGGTGCTGATTTAAGAAATGTATGCACAGAAGCTGGTCTATTTGCTATTAGATCTGAGAGGGAATACGTGATTCAGGAAGATTTTATGAAAGCTGTAAGGAAAGTGGCTGATAATAAGAAACTTGAAAGCAAGCTCGATTACAAACCAGTTTGAATTGGTTCTTCAAATAATTAAGGTTTATATTTTGAGTGATTTGTAATAATTTCATACAATTTCAGTTACAAGTGTGAAGTTGCTATAATAAATACCACAATAATTTTGTGACTCAACTCCCAATTGTTTATCAAATTACATGAAAATCTTATATACCATATATAACAAATTTATACATTTGTTTGATTCAAGTGACAAAAGAAAAGTATTATCACTAGTTTGTTATCCTCAGTCGATTTCATCTTGTTCTCTGGTTTTCTCTACACTTCCAATATCTTGTTGATTTTTGATATTCTCCATTTCTGCCTCTTCTATTTTTGTCTCCATGTCATCCAGAGTCTCTTCTATCTCTCTGCTTAGAGTTTTTTCTTCATTGTCCTCATCAAGTCTTTCTGAAATTACTTCTGTTTCCTTTTGGATACTTGCGGATTCTAAATCTTGAAATGTCCCTAATTGGACCTGGTCCTCCTTAAATTCACCTTGTTTTGGATACTTGTCCTTTTCTTCTTCGTCATTTACAGTCGAAACAGTTCCACTCACGAAGGTGGGGTGCTCATCATCTTTCCATAATGTTTCTATCAGTTCTCCTTCAGTTTGGTATTTAAAGTTGAAACCAGTAGAGCGAATGTCATCTTCTGCTCCACCATCTTTTTTCGGAGCTGGCACCGTCTCTATTAGATCATCAAATATTGTATCGGTGAGTCCTTTTAGTTTTTGTGTTTGCTTTTGCTTTATCCTATCCCTGACCATCTGTTTTTGTACCTCAGGTAGAACGAAATGATGCACCAAGTCTGCTATAGTCTCCTCTTGTTCGCTGACTTCGATAGATCTACGTCAGAAAAGTTGACAAAAAAACTAGGTTTGGATGGAAACTTCAGTTTTGCAAACTCTTCATTGCTATTGCTCTTCTCTTTTACATACCTTTCTAGTTGTGCGACCATGTTTTGTTCAATTCTATTCTAGTTGTGCGGCCATGTTTTGTTCAATTCTATGCGTTAAATTCTGAATATAAGAAGTAGCTTCATCGTTTGAGGCAAAGTCCATTCCTTCTGTGATTATATCTTGAAGATATAAATCCACAGTATCCTGATGTACTTTCACCATTTGTTTGAACATTTCATCATGTTCCCTCCTTCTACGGAGCTCTTGCTGTCGTCTTCCAGCCTCCGCAGCTTCCCTATCGTTTCTCTCTCTTTCATTCAAGAAGCAGATGGCGTGAGCTCTTCTCTCATCCAGTAGACGCCTCAGTTCCTTATTTAGGAAGTCTAGTAGAGACCCAACAACACTACCCTCTAGTTTGTTCAAAGATTTCTGCAGCTTTTCAATCCTATTGCGTTGAATGGCTTCTTCTCGTTGTTGATGTTTGATTTTCTTTCTGGTCTCTCCAATCACTTCCCTCTGTTCCTCTAACAAGCCTGTGCTGTATTTCAACTCTTTGATCAATTCGCGGCATTTATCCCTTCCTTCATAAATCAACATTTGAGATGCTCTTCCTTTCAACACGCTCTGCAACGTGATCAGGGCTTGATATTTGTCTTCCTCCATGTCTGGTAACTCGTCTGTTTCTGGAGTAGAAGCTTCTGAGATGGACTTGTCGATCCTAACTCGTAAGGTGCACCTTCTCTTGGTCGTCTTGTGCAAATTTTTCAATTCCTCGTGTAGCTTTTTCAAAACTGGTGTAGTCCATTTAGTTTCTCTCATGCATATATGAGTGCCTGGCAATTTGGCAGTATTGTAGTCGTCCTTCAAGATGGTTGCCTTGTCAATCCATCTTGGTAAGGTGTTGAATTCTTCGACTCCTATAAACTGTGCTTTATAGTATTTGAGCCTCTCGTCCATGACCTGGTGCCATCTCATGGGATGCTCCCCGTGTCTCATAAGCGGGGCATACAGCTCAGACTTGGGATGCGCATGTTCCTCTACCACGTCAGTAGCGTGGTACTTGCTCTTCACACCCAAGTGCTTAAATTCCAGCTTCCTGAGTTCTCGCTCGGTTCTCTTTCTCAACTTCTGAATCTGGGCGTTGGTTTCCGTCTTCTTTATCTCGGCTATGTTTTTCAACTTAATATAGTTTCTCTCCTTTGATTTGCGATGGAGTTCGTTAAGCATTTCTTCGAGCAGTTTCATGCGTAACTCCTGGATTTCATGGATTTCCTGTTCTCTAAATGCCCATTCGTCTCTCTCCATAGCATCGATTATGTCCCTTCTTTTCGCCAGAGTGGATTCATCAGTAGGCGGAGGTAAGTATTTCTCCCATGCTCTTTTCATTCGTGCTCTTTCGATAAGAACAACCTCATTCTTCCCAGCTGGTAAACCACTTCCCCATTTCAGAAAGTCCAGCTTCAGAAGTTGTGGACTAGTGCTTCCGTCATTGTTGAACAGCCTGTAATCTGGTTGCCACGGAGAAGTTTGCATCTCCGATTCACGATAATCGGTCTGTATGTTTACGTTCATCTTGTCTCCAGCTGCTCTGTCCTTGTATTCACCGTAGTCCTTTGGTATCTTCTTCAACGTGAACACGGGAAAATGAAGGAATGGTATGACCTCACTGGGATAGGTGACAACCGGTACACTGAAAAATTTCGGTCTATCGTGACCCTGGACAGGATGTGGCTTGTTGTGGATTTGCTTGAAATAGTGGTCGCTCTTCATTTTCTGCTCTTTGTATGAAGGTATATCCTTCGGTTGTCGAAGAACTAGTTGTTTTCGGGGATAACTGGGAAGATCGGAAAACATGGTGGAGAATACAGGACATACTTGGTATTTTGCCATTGCCATTCTAGCAATTATTCCTGCTTTATAATGATCTCTAGGACCAGAAACAACAAACAATGGGTCATAAACAAGATCTTGTGGTCGATATGATAGATTCTTGATTTGCTTCATCGACATTTTTAACGAAACAATTTTCCTCTTAGAAATTAATGTTGGGTATAAGATATTCTATTTTGACATAATTATCATATGAGAGTTTGATCAATTATATTGCCA
>TRINITY_DN85_c0_g1
GGTTTGTGTACTCTCGATTGTACTTTATGATGTAATTCCATAGAACAATCAATACATAATTCAAATCGAGGCACTATCGCGCTGTCAAATTTATGTATGTGCTTTCAATTAGAATTTGATTTTGCCGATTACGTTGAACAAAAATTAATAACAATGATTTCTCCTTAACACCGCCAGATGAGGTAGAAACTGCTCTTCAGCAGTATGCTACTTCTAGCATATTTGAGTTTGATACCCGGAAGGAGCTGAAATTTGCGAGAGAAACTGGAATTCATGAATCATAGCAATGTGCAGGGAGTCCGTATTATTGGCATACTGAATATTCTATGTTGGAAGCAATTTTGAGTATTAAAATCAATATAGATATTAGCGGATACCACAAACATTGTTCATCAAAGGATAAATAGTGGATATACCTCAAAAAAATCGACAGTGTTCGAAAAAGAACATATAAAAGAGTTTATAGCAAAAGCTTCTGATAATATTTCCTTATGTCGAAGGTAAATATAAAATGGCATCAAATTAATCGTTCAACTTCCATATTCTCATTGGGCGCATTCAGCAGTTGGGAACATCAATATTCTATGAATTTTCTGCTGAACGCATTCTATCAGTTTCCGCTACTGAGCGTATGCTATGGAGCGGTCGCCATCTTTGGTAGCGAATTTGTTTTATGCTACTTTTTGGTAGGATGTTGAGTAACTGACATTAGTGACAGTTGTGACAATGATTTTGGGACGAAATATAAATTTAAAATGAAGCAATAATTGAAACTGAAACATATACGTTCATTAACATTCTGAAA
>TRINITY_DN85_c0_g3
TATTCTATGAATTTTCTGCTGAAGGCATTCTATCAGTTTCCGCTACGGAGCGGTCGCTTCTAAATAAATTTTACGAGTATCCTAGAGAACCTTGGAACTCAGACAACTTCTTCAAGGAAATCTTCACGAGTTATTTAAGTAAGTAATATTCTTCACAATCCATAGAACATATATTGGGCGCGTTCAGCAAACTCAACAGTTGTCAATATTCTATGAATTTTCTGCAGAACGCATTCTAACAGTTTCCGCTACGGAGCGGTCGCCATCTCTGGTAGCGAATTCATTTTATGCTACTTTTTGGTAACTTGGTAACGAATTTATTTTATGCTACTTTTTGGTAACATGTTGAGTAGCTGACATTAGTTCCCATATATTGAAGAATAAAAAAGTAATAATACCGTAAGCAAACTTGGAAATTAAAATCGATATTATAACAGAAAACTGTC
>TRINITY_DN85_c0_g2
CGCGATTTTAAGGATGTATTTTTAGAATTCTCGTAATAACATAATGAGTCAGTATTTGTATATTATTGAATCAATTATCAGGTTTTATATGGATCATTTTGATTTTCTTCGGATTGAATTGAACCACAACTATGAAATATGTTGTGATAATACCCAAAGAAGCTGCCATTATGGTTCGGTCAATTTCAAAACATCCAGCTCCAGAAAATTTTGGTCGGAGGATCTTGAACTTCTTGATGTACTCTGTCAACTGAATGAATTGATTTTCACATTGAACCGAGTGATTGAAACTGTTATTTCTGATTTTTATTCGGCCTTCGTGCAAGTAGCTATGTTCTTCTGATGATAGTTGCTCTACGATGATGTAAGTGGATAGATGCCATACTGTTTGATATTCGCTCATAACCCAATCACATTTCAGAATAATAATGACCAGAAAATATTCTCATTGGGCGCATTCAGCAGTTGGGAACATCAATATTCTATGAATTTTCTGCTGAACGCATTCTATCAGTTTCCGCTACTGAGCGTATGCTATGGAGCGGTCGTCATCTTTGGTAGCGAATTTGTTTTATGCTACTTTTTGGTAGGATGTTGAGTAACTGACATTAGTGACAGTTGTGACGGTGATTTTGGGACGAAGTATAAATTTAAAATGAAGCAATAATGGAAACTGAAACATACGTTCATTAACATTCTGAAATGTTACTCTGAATACATTTCCAATATATTGAAGAATAAAAAAGTAATAATACCGTAAGCAAACTTGGAAATAAAAATCGATATTATGAGATAATTGTCTCTCATCATAACGTTACCTTCAAGAAGGACCCACAGAACCTATTGCTGTCTATGCTGTCAAGAAAAGGAGCAACCCGTCAAGCAGGTAACTAACGTTACCAAACTGATACCTATCAGTAGCGGAGCGGAGCTACTCAT
>TRINITY_DN126_c0_g1
AGGAACAATAAAAAGGTCAGGAATACAACACAATCCTAAACTATGAAGGTTTATCATTGAAAACATTAAACGAATAGCTTTGTCAATGAGATCTTTCGATTTTCGGTGTTCATCAAGGATCTGTTCTAGGGTCAGTAGTCTCCTTAGCAATCCTATTCATTCAATATTGTCTGATTTCAGTCTAATCAAAATATTTACCAAATAAATTAAGCGTCCTGCGTGCATAATGAAAATTATCGTAAGGAAGCTTCTTATGAAGATCAGAATTCTCCTGTTGACGTGAACATTGCCCAATGAAAAGGTCAGGA
>TRINITY_DN177_c0_g1
GTTCTGTACAAAATTTACAAAAATCAACAATATGGTCCCTCAATTCCTGTGAGTTCAACGTCATATAATATACAATTCAATAAAAAAATATATCTACACCTAACTAAAAAAATGAGTTATCATCACGAGAAAATAGTTTGATAATTGCTGTACATATTTTGAGGCGCTGCGATGAAATTTATATTATATTGAGGTTCTACATTTTCACTTTTAACTGGCACTTTAACAGATTGTTCACTGGATTCAGCATTTGAAGGAGGAGGTGTTGGAG
>TRINITY_DN132_c0_g1
GAAAACCATGTACTGGACAATGCAAAATCAAGACATCAAATTTGTACAGAAATGAATGAGAATCTTAGAAATAATTTTAATTTGAAAAAAAACAGTGTCGTACCATTTTGTTCTTCAAAAATATTCAATGCAGAACCCATTCACACGCCACTTGTAAAAATAATAAAATTGCTGATGTACGATCAGAAAATGCATTTTGATTCAGTGAAAACGTGTATCAAATTTCATAGCATATCAATTATGTGGCAAATTTCACTCTGAAGCCCATTTAGTATTTTCACATCGATGTAATTTATGTTCGAAAGATATGACAATTGTTTTTTCTCCAATATAATGTATTAACACATGCAGTAATTGTAACGTGACAACGTTAAGAGGCAGCTTTCAAAAAGGATGAATGATTGTATTGTTGCATTGAATCAATTAATTTGTCAAATGAGGACTTAATTTCATGTGATTTTAG
>TRINITY_DN80_c0_g1
TCTGATTATGGTTTGGGGGCGGTTTTGAGTCACGTAATGCAGGATGGTTCAGATAGACCTTTAGCTTATGGCTCAAGAGTTCTTAAAACAGCAGCAAAGCGTTACCCTATGTCCTACGTGAGCGACCGTTTCCAAGCCAGTTTATAGGTGCACCCTCTATCTGAGGATTCCGGTGTTTCATCCCGAGATCACTGGTGGAATCTTCAGGTTGGTAACCCAGTGATCTCTGCCAAATACACCTTCTCACTCCATCGTGAAGGGATGACTCTACCCAAGTGCGGTGAGTCTAACCCTATGTCCTACGTGAGCGACTAATGTTACGACGCGAGCGACGCGAATTTTATGTACTACGCGAGCGATGCGAGCAGCGCGACTTTCTTTGTCCTACGTTGAAATCTACAAAAGTGTCCTACGTTGAAATCTACAAACGCGACACGACGCGACATAAATATGGTTGGGTTGGGATTGTGCATTGCGGAAGATCAGTCCGTTGTCATACGCTTGTAGAGAAACAGTTATAATGAGGTGGTCAAGAAAACGTAAATTATTCATATGTGAAAATGTGGCTTCAAAAATGCTAATTGTAAGACGCAGAAAAATGGGAAGAAAGAGAAATCCAACAAATTAATTTTTTTTGGAACGAATGAATTTTGGAGAGTTTCACCACTTATATAAACAATTAAGGACTTCTCCAAATTTATTCCACAGTTATTGTAGATTGCTTCCTACAACATTTGACTATATAGAAACAACCACAAAAAAAATCTAAGAAATACGTAAACCATTACTGAATTGAAATTTTTTTTTCAATCTGCATGGATACCTACGTATTACATATAAATAAGGTTTATTTATTATTACTCAATGATATATTAACCTCAACTATATTTATTTCCTTCAAATGGATATTTCTTCAGCATTAGTAATATAAGTTATGCGTGACGACACGGCGAGACAAATATATGGTTAGGGTTGGGAA
>TRINITY_DN14_c0_g1
AATTTCAGCAATAAAGTTGTTAAGTTATCCAAGATTCTAATATTTTGGAACGTTTCAAAATCACCTCGTAAAATTTGGCCAGAGATAACTTGGGCACCCTGTATACAAGATCTCGTATATGATGGGAAACATTTTAATGGAAGATAGAAGGCATCTTATTCATCAATCAAATAATTATACAATTTTTATTGTAAAGATAATTTTATTTGATAGTATTTCAGATAGTAGGCACCTTTGATTTATTCCCACTTTGGCTTTGATTGAGACTCATTAGGTTAGATTGAATGAATGATCTAGTATGTAATCGTCGAAATGTGTTTACAAATAACATTAACGAGTTTTTTCATTACCTATCCGTCCTATGGAGATATGAAAAGTTAAAAATTTATAATACAGTAATAAATAAATGAATGCCCCTTCTGCCAAAAC
>TRINITY_DN167_c0_g1
GTGGATTTGGAGGCGGAGCAGGAGGCGGAGCTGGTGGTGGAGCAGGAGGTGGGTTTGGAGGCGGAGCTGGAGGTGGCCATGGAGGCGGAGCAGGAGGTGGTTTCGGAGGTGGCAAAGGAGGTGGATTTGGAGGAGGAGCAGGTGGAGGAGGAGGCTTTGGCGGCGGTTCCGGGGGAGGAATCGGTGGCAGAGTCTAAAATCAGATTACATCATATATCAAATATGATGTGAACGAAGGGAGTAAACATTCCTTATGTTTACAAACTAATGCATGCGGCCAGTAGAAAATGCTCATGCAAAGATTACTAGCTTTATGACCTTTATGATTATGACTACTATTTGTACTTCAATTCTACATAATAAGAGAAAGACAACAAAAATGAAAGGGAG
>TRINITY_DN157_c0_g1
GGATGCCGTTGCAGAACTTATTTGTTGTTATGCATTGCTTGTTCGAGCACTCGTATTCGTTGATTCGACATGGGGCGACGTTGATCACTGCTAGTTCCAAGGAGAGTACGAGGATCCCCCAGATCTTTGGCATCCTTCCTCCCTTCGAAGGCCTCTTGTACCATCAGCTTCCAACTACGAAATCCTTTTTTCCGTCGAGGAAAAACAAGTACACGAGATCATGTTTACTCAGGCGACTACGAAACACTCTGTCTGCTCCGTACACCTCTACACCGATACCGTCGAGAGAGACGATTAGGGCTGTAAAC
>TRINITY_DN33_c0_g1
ATCAAATTAGACCACATATCTGGAAACGGTTTTAGTTTGTTACACGTCAAGAAGTTCTGTCAGCCAAAAAATCGTTTTTTGAGGGGTGGTAAGGAAATGAATATCAATATTCCGAAGTGAACAAAATCATTCATCAATGGTTTTGTCTATGAAAAATTATTATTAATTATGGACATGTTTTTTTTTCAGCAAAACTACCTAATTTTATGCTCTCTCGAATGATACATCAACCTCTGTGCCAGCTGCTTGTCCTCTGCCATAAAACGAGTATCATGGCTAACAAAATAACAACGAAAAGTTCAAACATTCCAAACCCAAACTTGCTCTTG
>TRINITY_DN79_c0_g1
ATAACGTTTCCGCATTCCCTCTAAGACGCTAGTTTATTTTCGAATATAAACGTTTCTAATAATAAACCAGTTACAAAACGTGCAACTGCCTAGTTTCTCTTCAATTTATTGTGTTCGGAAGTATCCCTTTAAACTTATACTTTGAAAGTGAAAATCATCAAGAGTGATTCGAATGAATGGCAGACTTCGAGAATCCACACGACAAAACTGAACTACATATAGCCGTACAAGAAAATAAAGCAGCGTTGGTTAGGAAACTGCTTAACGAAGGTACTGATGTCAATTATAAGGATATAAATAGCGGCACACCATTGCATACGGCAGCCGAAAACGGGAACGTTGAAATTGCGAAAATCTTGCTAGAGTTCAAAGCCGACATCCGCGCTAAAGACAAATACGGACGGACGACCCTGAATGCAGCCTTTTGGAACGGCGAAGAACTCGCAGCGCTTCTTCTAGACAAACTCGATGACATCAACATCTCTACAAACAATAGAGATGACACTCCTCTTCATCTAGCCGTGGAATCATGCTATCCAGAATTGGTCAAATCCATATTGAACAAAGGCGGTCGGGTGAACGCCAAGAAATATAGAGGTAGGACACCCCTTCACGTTGCTTGCGAAGTTGGCAACGGAGCTATAGCAAGGAGTCTTTTGGAGTTCGGCGCCGATTACAACTGTAAGGATGATACTGGAGACACTCCTTTACTTATAGCTTCCAGAAACGGAAAAGAAGAAGTAGTGCGAGCGCTGTTAGAACACCACGTTGACGTTAACGTACGAGTCAGGAAGGGCGAAGCGGCTTTGCATTTCTTGGTTGAAAAGAAAGTTAGCGAGGAAACAGTTAGGTTGCTGTTAAACAAGGGGGCTGAGGTTAACGTGGGCTCCATTATAAACAGAACACCGCTGCATATTGGTGCCATAAATGGTCAAACCAACACGGTTGAAGCTCTGCTTGAATATGGAGCTTATACAAACTTTCAAGACGCTAATGGACAGATTCCACTCCATTTAGCTTGCATGCAAGGTAACGAGGACGTTATCAGATTATTAATTCGTTATGGTTCTAATCTTGATCTTGCAAATGAGTTGGGTAAAACCCCGCTCCATTACGCGGTGCTTTTTGGTTGTTGCAAAATTGTCGAGATGCTACTTGTGGAAGGAGCAGATCCAAATGTCCGGAATATCGACCATAGAACCCCTTTAGCATACGCCGTTTGTGAGATGTTGAACTGTGAAATGGTCTCTATTTTGTTGCAGTATGGCGCAGATGTCAACAGTCAAGACATATACGGATTAACACCCCTCCATATAGCCAGTAGAGCGTCTGGTAAAGAATTGGTATCACATCTTTTGGAAATGGGCGCTGATGTGAACGCCATAGACTATCAGAACCGAACAGCCTTGGACATTGCTTTGAACGAGTCAGTTGGAAATCAAAGAGTTATTTATATACTGAAAGAAAATATCATTATGAGAAACACTGCTGATCTGTATGTTTGTGAAGAAAACTTGAATAATCTTGAGTTTGATGAAGAGCTAGAATATTTTCAAGAGGTGTGCAGAAAGGAAGTCGAGAAAATGGAAAAATTTAAACTAGGAGGAAGCACAGTTTCCTATCACAATATACTAACTAAATCCATACACAAACTAGCTAAAATCATAATGAACCAAGATGTCCTAAGAGCGTTGAAGACAGTGAATCATCAGAATGAATTCCCTTTATATAGTAATATTACTGAGCGGATAATAAAAAATAATTTCAGAGACGCATTTGTGAGGAGACAGTTATTAGACAGTTCTATTGAATTATTCGATTTTCTCCTGAAACTGCCTCAAAACTGTATAGATCATATTTTGATCTATCTTAGTAATGACGACATGGTAAACTGGATAGCCTCTTTTGATAAGTAGATCTAAAAAATACTAAGAATTAAAAATTGTTTTTAAAAACTATAATGGAGGTTGCTCCTATTATTGTGAAACTGATTTCATCATGTTTACTGAATAATGTAAATCCATTGAATACGTTTATACAATTTGTTGAAATAAATAAAAAATTTTATGATTTATAGTCATAGCCTGTACTTACCTTTGACGGGAACCAATTAGAAAAAAGTTGAGAAACTGAAGCACTAAAATAAAAATCTCTATCTTCCAGTTGATATAATTTGTATTGAAGTAAATGATTAACGTTCAGTAGCATGATTTTTATGCAATAAGATAGTCACCCACATATTTTGCCTAAGAATAATAAAGGACTACATCTG
>TRINITY_DN142_c0_g1
GGTGACTATGTTGACTAATAAATTCAAATGTTTGAGAAAACATGTATTTTTATTGGTTAGGCCTGGGACTAATTGAATGAAGTCTTCTTCTCTCAAGAACTGTGCTTTCCAAACTTGATATTGCGTGAAATAACATTTCAAAACTCAGGATTGAGCATTTCTCTTTTCAAAAATTTGTAATTCGTGCTAGGGTAAGTCATCATTGAGATATAACCTTTAGCCTGCATTATAATGATAGAGAAATGATGAGTTTTCATTTCTAATAGCCATGATCAT
>TRINITY_DN114_c2_g1
GTCAAGCAGTTAATTGATCTCATTTGTTTGAGTAAGCCTATGATTGGTTCGATTAAATTAAGTGATCTCTTCTTATGCGCTTGGTTGATCATCCACACAGGATAGCCAATAGAAGGATCGAAAGAGGTAATAACCACATTTTCGTTCTCGTCTATGTTATCTGGTAGTACATCCTCATTTTCCGTGGCCACCGACTTTCTAACCTTAGACACTTTTTTCACAATTCCTTCGTATTATATTTTGGATCTTTTCTGTTGGCTGCCATTATGGAGGCGAAGTTCGGGAAAGGTTTTTCCATTTCTAGAGTGTCTCGATTCCAGTTCTCAAGAAGAAACAACATTTCGCTCAACATTATGTCGAATTGGTAGAAGTAGAACGCTGTTACCTCATCCTCTTGCTCTTCTACGACTTTTTTATTCATTCTTATTGAAGATTTCGCTCTGAGAGAACCTTTTACATCTTTGGATTCTTTGGGTAATATAGTCCCACTTTGTGTCTGATGAGTTTCATTCCCTTTCGGAAATTTTGTTGTTGTTT
>TRINITY_DN89_c0_g2
GTGGATGCCAATAGGAGGACTTACGCCGCCATGGTAACCAAACTGGATGAAAGCGTCGGCACAGTAATCCAAGCCTTGGCCGCCAAAGGGATGCTGCAAAACACAGTCGTGGCCTTCATCTCGGACAACGGGTGCAGAACACAGTGGTGGCCTTCATCTCGGACAACGGCGCCCCCTCAATAGGCCACTTCAGGAACTGGGGCTCCAACTACCCCCTTCGCGGCATTAAGGACACCCTCTTCGATGGGCTCCAACTACCCCCTTCGAGGCATTAAGGACACCCTCTTCGAAGGGGGCGTCAGGAGCGTAGCCTGCGTCTGGAGTCCATTACTGGTACAATCGGGCAGGGTGTCCAGAGACCTGATGCACATCACCGACTGGCTTCCTACCCTTTTTACGGCTGCCGGGGGGGATTCGTCCCTGTTGGATTTGGACATTGACAGCGGCCGGAGGGGATTCCACCCTGTTGGATTTGGACATTGACGGTATCGACCAATGGGCCAGTCTTGTCTACGACCTGCCGTCCGCCAGAAGCGATGTTTTGTTGAATATAGACGAGAAGACTAGGAACGCCGCTTTGAGATTGTCGAACTGGAAGCTTATAGTTGGCAGCAGCAACAACGGAAACGCCGCTTTGAGATTGTCAAACTGGAAGCTCATAGTTGGTGAGTTTTGTTTTTTATACCGGTTGGACCGATTGTTCGAGCAGCAGCAACAACGGCTCCTACAACGGCTACTTGGGCGAGCCGGTCCTGGAGAACATCCAGGAACCTCAGTACGACCTGAACGCCGTGTACGACAGTCCTGCTGGCCAGAGCGTGAGGAAGGCCTCCTAGCGTGTACGACAGTCCTGCTGGTCAGAGCGTGAGGAAGGCCTCCTACACGCCACTCGACGTCGAGGAGTACGCGAGGATCAGGAACAGGGCCACCGTGAAGTGTGCACCGAACGGCGAAAAGAACCCCTGCGATCCATCCAGTAATCCCGTCTGTCTGTACGACATACCGAGCGATCCGTGCGAAGAGAACGACCTAGCCAAGTACTTCCCCAGCGTGGTGAGACGGCTTAAGCGCTCCCTGGTGGAGTATCGCAAGGACCTGAAGCCGCAGCTAGAACAGGAGTTCGACATTGAGAAGGCAGATCCCAAACTTTTCAAATATACTTGGAATCCCTGGATCGGCTGTGCAGACGTGGAGTGCACTTCTTAATTGCTTAAATTATTTAAATGCGACGGTACTTGAACAGAACCTTGTTAGATCTCATGACTGCTGTTAGACGCGTGGCGGAGGTCACGTGTGACTTGTATTTATTGATGTTTGAATTAAAGTGGATAAGAG
>TRINITY_DN98_c0_g1
GTAGTCTCTGATATAAATTATCGCTATTGAAGGAATTATCACCGCAAGAAAAGAATATGTGGGACAAGTCGCCAAGCCCCCCACATCCACATAGGGGGGAATCAATGACACCTATCCTTGTCAAATGGGCTGGAGTCAGACAATGTCCTGATTATAGTAGTAATATTTGACCTAGGACTATTCCAATCCTTAAACCAGGTTTCTCTACGGTATGCGGCAGGTTTAACCACTGATGAGTACATTCTGCCCTTCGTCAGACCAATCTCTCTAAACCGCTCCGTCCACTTGATGTCGATCATATACCAACGCCAGTTATTCAAACCAATCAGACATGTATTAATTAGGTCAACCATCTGGTTGACATTCTTCCCCGAGCAGAGCAGCGCAAAGTCGTCTGCATACTGTATAAGGTGAACACTATGTGCCAACAAGTTTGGTGGGCACCATGAGTACAGCAGAAAAAGAAGGGGACTCAGGCGTGATCCCTGAATAAGGCCATTGGTCACGTTTTTCCTGAACTCTGTTCCGGAAGATCCTGTAATTACCACTGATCTATGACGGTATAGTTGATATTTCAGGTTACATAGGTTCCTGTGTATTCCGACGTCTAGCAAGTCTTGCCAAAGGATGCCCAGATCAACGCAATCATATGCGTTAGAGACGTCGAGAAAGATAACCAGAGTGAACTGTTTCCTGTTAAATGCTCGGTATATATAACCGGTCAGAAGAGTGTGACAATCGGAGATAGATCTCCCTTTCCGAAAACCGAAAGTGAGAGCTCTGTTCAACTGCTCCTCAATAGTTTTTTCAATCCGCTCCTTTACCATTCTTTCAAAAATCTTTGTAATGCACGGAGTGATTGTGATGGGCCGATAGCTGGTGGAGACATTGGCAGGGCAATTCTTCTTAGGAACCAGTACGATGAAAGAAGTCTTCATACAAGACGGTGGATTCCCCTCCTGCAGTAACTGGTTGAAAAATCGGAGTAGGAGAATTCTCGCAGAAGGCGGAAGATGATGCAACATCAAATAGTCAATGCCATCCTTGCCAGGGGTAGAGTTCTTCTTCATCTTAAGCGAATAGTTCAGCTCATTCAAAGTAAAGGTGTCTTGATGTCGATCATATACCAACACCATATTAGCGGATGGGTCCACTGGAGAAATTCAACACTGATCATTCACCCCTTGTGTCCAATATATCCCTACAACACTGATCATTCACCCCTTGAGGTCCCTCCCCTCGGGGTAGTCCTGAAAACTTTTTAATAATCTTCCAAAAATTTTTGGTGTTCCTGGTAGAAAGATTTTCAGTAAACGTCCTAAATGAATCCCTTTTATTTTTCCTCATCAGTCTCCTGACTTTGGCGACTTGCTGTTTATATTTGATAAAATTTTCCATGGAGGGAGCATGCTTGTATTCCGTCAATCGTAGTCTCCTTAGAGAAACTTCAGCTGCAATCTCGTCATCCCACCAGTGGACACTTTATTTTGAACTAGCCCACCTTCTGTATCTGGGAATAGTCTCCTCTGCGGCCGTCTGAACCATCTTAATGAAGTCTGGAATATCAGTCACCAGTCCCGTACTAGAACTGTCGATGATTCTCTCAGTATACTGCTGCCAATCCGCTCTCTTGGTGTTGAAGATTCTCGAGGTTTTCCTAAGAACTGTAGTGTCAATTCCATGTCTCCGGACTTCCACAACAATGGGTCGATGATCGCTGCGTCCTGTGTCAGGAATGACTGACCAATCACTCCGTATGAGCAAATCTCCTGAGCAAATGGACAAGTCCGGGGCACTTGCATTCTCATGGGGGGCTGTTACCCTAGTGGGAGTACCATCATTCAGAATTATATAATTATAATCTCTTACAAAAGCCTGTATCACATTACCATTGTGATTGGAGGTACTAGAGCCCCATGCAGGATTTTGAGCGTTGAAGTCTCCTAAAAGGAGGGAAGAACCGTTCGACAATTGATCCAATTGATAGAAGAGAGTTTCCGTCACATGTACATCCGGTGGCACATAGATGTTGAATATTATAATACTCTCACACTGTATCCCCATAATTTGCACCCTTTGAGGGAGGTGTAACCCCTGAGTGTTGACAGTATCATAAACTAAGGAATTTCGAACCGCCATTGCAATTCCACCATATCCATCAGGCCTGTCTTCTCTCAGTAAGGAGAAGCCACCAATGTTGATTCTGTGGTGATTCCTTAAAAATGTCTCATTTAAAACAATGATATCCGGCTTCGTGTCCCTTATGAACATCTTGAGATCATCAAAATTGGCATTGAGTGATCTGATATTCCATTGTAACATCCGCAGCATCCTGGTTAATCCAATAACAATATTCAAACAATAATAAAAGGTGATCCAAGATGATACATGGGTCTTGTCACAGATAAAATACGAGATATAAAAATTGTTCATCGAGATGAAGAGGAATTACCATATTTCAGGTAATCCTCCCCATATGTTACTTGTTGCCTATAGTGACTAAAGTCACTGTCTTCAATAATCATGAACTGGTCGTTGTGGTTAGCAGCTAAGCTAGCCTGTGAGAGCCGTTGGCTCCCTAAATCCGTCTGGCTAAGATCATTGCCAATTGAAGTTTCCTGAGAAACAGGGGTCTTCGAGAGCTGAATAGGTGTTCGAGAATAAGATATAATTGGAGATACAAGTCGGCTGGGAATCAAACAAGCATTATGCGCAGCTCTATCATAACCTGTTTGCTCTGAGATCTTCCTTTTTGGACTTGGTGCACTGCTAATGGGTAGTACAGAACAATATGATCTGCTTTGGTTAGTAGCTACAACATTAGCATATGATTGTTTACGTGAATTCATTAAAGAGGTCTCAGACCTGTCATGTGGCAGGGTGGGAAATTCTGGGAGACGAGGTGCTATTTGCCTTCTACATGTTTTATCTGCCTCGTATAAAGATACATTGTGCAAGGCCATAATTTCCCTCATCTTTACCTGTCTTGCATATTCTTGACATTTCCTGTCAGTTGCTTCGTGACCTTGTTGGCAGTGAATGCAGCAAGGTTCCAAATCACACGGTTTTTCATCCTCGTGATATGATCCACATTTCCTACATCTGAATTTACCCCTACAAAGGTTACGAACATGACCATAACGCAGGCATTTATTGCACTGAACCACTGGGGGAATGTATAGCTCCACTGGCAGTCTGATGGTATATAGCTCAAAATACTTGGGAAGGGTCGTACCCTCAAACGTCAACACGCAAGTGTTTGTTTTCACAAAAATGGTCCCATTTTCTGTAACCTTTCTACGGTTGAATCTACGTACCCTTATGCATTTGACTTCAGGGCTCAATCCCTTTCCGATGTTAACTATCTCTTCATCAGTTATGTCTTGACCGATATCTCTCACAATACCCATGGTGGAAACAAACCTTCCTGGAATGTAAACATCATAGATTATGGGGCCAAAGTCATTATACTTGACAAAATTGTTAGCCTGTTCCGCAGATAGGAATCTGATACCCACCTTTATAAGTCCCTTCCTACTGATATTCCAGGAATCTGATACCCACCTTTTTAAGTCCCTTCCTACTGATATTCAAAATTTTAAATTTTCTGTATTTCTCATTATTATAGATTTCCTTTCCTACATTCAATGGATTGAGATCCTTGATCTCTTTTTGAGTAGTCTCAACTATAATTTCGAATGGACCTTTGTCCTGTGGAGAGTAAAAACAATGTCGTTTTTTAAATCTGGCATCTCCCTGAGAGATGGTTAATAAGATTTTATCAATTTTTTCAATCAGTATTCCCTCTTCGCAGCAAACCGATTCTGTCCTCACGGCTGATAATTCCTCCTTCAATAAATTAACATTTATCGAATTCCATTCTTCACTATTAACTTCCGAATTCCATTCTTCACTATTAATATTATCTAATGCAAGTTTTGCCCTAGGGGATAATATTTCCAGAACCCGAGGCCAAGCCTCGGGATCTGTTTTGTTCATGTTTAAAAAAAACCAAGAGATAAGGAGCTTATCTCACCGCTAAGTAAATTCCCACAACGTAGAGAAAAAAAAAATTCAATAATAAAAAGAGGAAAAAAAACGAAAATTCTACAAAAACAAAGTAATTGGCCCTAATGGCCACAATGTTTATAAAGTTCAGCACTAATTATAAGGTAAAAACTCACCACTATAAGGAATAACAATCACAAAGGTTAAACAACGAGAAAGTTTTCAGGTTAATTGAACTCCAATCACCCAGATATCTTGCCCTGTCAACAGCCTAACCGCGAATGGAATAAATCAATAAGTAATTGAATAATTGAAATCTTGGAAATTCAAAATTAACAAACGAATGTTTACTTGCTAACAGAACAAGGTAAAATGAGTAAATAACTTGACACTAAGGTTAGGTTCACGTGCAAATCGACGATTTCTATGATATGGTTCAATTTCTCTAAGCTGCGCTAGAAGGAATGCGCGTGTCCGACAAATGGAAAATCCTCCAAGTGTTCCTACTGTATAGTTCCTATACTGTGTTCGAATTTATAGCCGATCAACTACTGAAAAATGATGCTTTATTTGTCTGACAGGATATATTACATACAATCACAATGACAATCACTATAATCTATATCATATCCTTGTACAGAGTGAAATATACAACAACAGGTTTGAGTCGGTTGAAGTCAGATGCCCGAAAATTCAAACCGTTTATTGGTAACAGAGTTAGTGAAATTTCTGCTTTCTGCTATCTCAATATTCTTCTTTGTTGTTTTAGGGTTATTCAGGAATATGGTACTGTATGTCTATACTCTGATAATAGCCTACAGATCATTTTGAAGGTTGTGCTTGATGTTTTGCTGCAGATTCCTAAGTTTTTATATGTGAGTATTCTAAAGTAATCTGCTTGAGTTATAGCTGTCATCTTTTGTGTTTTGATGAGAGCCTCAAAAATTCAGCTTACTGTCCAGTTGTACACCCAAGTACTTGCACATTCGTAGGTGTAATTGTGTTATTTCCAAGTACAATATTTTTGGAGTTAGACTTGATCTTGTAAAATATTATACATTTTGATTTTTTTGGATTGTGTTGCGTTCTCCAGCGTCTCATCCATGCTACAGTGACATCTGATAGTTCTTTTAATTGCTGCATACATTTGTTGAATGTGGTACCCATGTGTCATCAAAGTTGTATAATCCGCAGTTGCTGTTTGATATGATGCTCTGAATCAAAGTTGTATAATCCGCAGTCCTCTAGTATATGAGCTTGCTGTTTGATATGATGCTCTGTTTCTTTGTTGTAACGTGTCATGGCAATTATACAGCAATGAAGAGAGGGGTGAACCTTTAGCAGACCTTGTGGGTGTGTGAAATATCATTTTTCACTAGGACCTGGAGAATTCTCCCGAAGTGTTTATTCCTTAAAGTGAATGAGCCCTTCGTCATTATAAACTTCCATTCATTGCGATTCAATCGTTTCCTCGAACTTCATTGTCTTGTATTTTCATCATTACTGTTAACAATTGACCGATGAGACATCATAAATCGATGGGTTTATTCCTCAATGAGAAAAAGCTTTTCCTCATTAATAAACTTCGATTCATTCTCTTTCTTGAACTTCTTTAGTTTTTATTTTCATCGTCACTGTTAGCAATTGACTGATGAGACATCATAAATCTGTGCAGCCCGAGTAATCATCTATCAATTTTTTGCTCCTGACACTAGAAGTTCCAGTGATCATGTTCTCGATGGTCCTTCTCGACCTTCTCCTACACCTCCAGAACAACAAGAGGAGCACAACAGAGAACAACAATATAGCTGCACAACTACCCCACACTAACTCAGCGTTGTACCATTTGAAACTGTG
>TRINITY_DN111_c0_g1
GATATATTGAAAATAGTGAATGATTTATTGGCGAAAAATAGGAGGATGAAGGAAGAACACATAGCTCATATATTGAAGGAAATCATAAAGGCCGTCAGCTACCTACATGAGAAGCACATCATGCATAGAGACTTGAGAGCATCGAATGTTCTCTTAACGAAAGCAGGTGATGTCAAAGTTGCAGGCTTTGGCCTGTGCATCTCCTTAGCCAGCACGTTTGGAAGAGGTAGCTCAGCCATAGGTTCTCCAGCATGGATGGCTCCAGAATCGATCCAAGGAACTAATGGTGATGAAATCAGCTACGACAACAGATACGACGTATGGTCTCTTGGTATGGTAGCCATAGAACTAGGAGATGGCCAGACTCCTTTCAAAGATATGCACCCCACAAGGATTCTGTTTCATGTTGTGAGGAATCCACCGCCTACTTTGTATAGAACAACTAATTGGTCGGAAAATTACAACGATTTTATTGCTGAATGCCTGGTGAAGAATCCTGAACATCGCCCATATATGGCAGAACTGCTTGGTCATCCATTCATGGAGGAAGTTCCAGAAAATAACTACCACCTATCTACGGAATTAACCAGTCTGCTCAGTTCTTATGAAGAGGAACCCCAAATACCTCAAGACGACGTCCACGTTCTAAATAACATCCTATGGGAAGGAGAAAAAAGACATGAGGAGCCGATGTATGTGGAGGACCTAGCAGCTCTAGATGATTGTAACGAAAAGACTGTTCTGTCACATATCGAAAGAAGGTTCAACGATGGTAAATATCAGACATTCGTTGGAGAAATATTGATTACTCTGAATCCCAATGTTGAAGAAAATATATACACCGATGAGCACCATGCGAAATACTGCATGAAATCTAAATCCGACAACATTCCTCATATCTACGCTATCGCTGATAGTGCCTACCAAGACGCTTTGCACCATGTTGCTCCTCAAAAAATAATACTCTCTGGAGAAAGTGGATCAGGAAAAACTAAGAATTTCCTGAATCTCGTCGAGCATTTACTCTTCATTGGACATAATGAGAACATTCAAATGACACGGCTCAGGAGTGCCATCGATCTAATACACGCTTTTACGCATGCTTCCACGCCTTACAATGATTTTTCGACCAGATGTATATTAAAGACTGATTTGTCTTATGGGAGGACTGGAAAAGTGACAGGGGCTACATTCCTTGTTAATTTATTAGAAAAAACTAGGGTTTCCAGTACTAACATGCATCAAGCAAATTTCAACATTTTCTATTATGTTTACGATGGCTTAGTAAGCGAAAATCTGCTAGAAGACTATCAGCTCGACTCAAACAGAGGCTACAGATATCTAAGAATATTAGAAGAGGAAAGATCCGAAAGACCAGGAGTTGAAATAAACAGAAACATCATCAAATATAACAGAATCAAGGAAATACTCCAAGAATTCGAGTTCACTGACCAAGAAAGAGAGGCCATTTTCAAATGCTTGTCAGCCATTTTGATTTTGGGAGAGGTAAGATTTCAAGAAAGGGATAACGAATCTGCCGCAATAGCCAATATTGAAGTGGCCAAATCTGTTGCGCAACTGCTCGATACGAACGAGAAGAAATTTTGTTGGGCTCTGACTAACTATTGTCTGCTGAAAGATGGAGCTGTAGTATCCAGGAAGAACACCTGCGATGAAGCTAGAGATACTAGAGATGTTTTGGCAAACAATCTATACTCCAGATTAGTGGACTATGTTGTAGCCCGCATCAACCAGAAGCTTTCTCTAGGAAAAGCCATTTTCGGAGAAAAGTATCTCATTCAGCTTCTAGATTATTCAGGATTCGAATGTTTCAAAACCAACGAGTTGTGGCAACTTTTCATCAATATATTCAACGAGCAAATGCAGCACTACTATACTCAGAGGATCTTCAAGTGGGAGATGGTAGATTTAAACGAAGATTCTATAGAATACGAACCGATCGTGTATTACAACAACCAGAAGGTGTTAGATACATTGCTAGGAAGAAGTGATGGCATCTTCAATATAATCGGTCAAGCTTCGAAGTTGGAATATAATGGAAAATATATTACAGAGTACATTTCGAATATGGACTGTGGACATATCACAACCTCAAAACACATGGAGTTCTCCATTAGCCACTATACAGGAACTTTGAACTACAATGCTAAAGAAATGCCTGACAAAAACAGGGACTTCCTACCTCCTGAAATCGTTGAAACCATGAGATGTTCCAACAATTCTTTTATAAAGGCCTTGTTTACTGGTAAATTGAACAAATGCGGAAATTTAATAGTTGAACTTGAAGAAGACTTGACAACGAAAAACACGCTATCTACTGATTTACAAAAGGGTGCCAATGCGAACAAATTCTCCCAATCGAAGAAACTGAGAACTTTGGCCACAATCTTTAGAGCTGTTTGCCTAGAGACCATAACTGCTCTGTCCACTGGAAGTACATCTGGTGGTACCCACTTTGTGAGGTGTATCAAGACGAATTTGAAGGCAAAACCGAATCATTTCTGTAAGGAACTGGTGAAACAGCAAATAAGAGCAATGGCAATTCCACAGACAGCTAATATTCGCAAGGAAGGTTATGCCTACAGAATTCAATTCTCAGAATTCTTAAAGAGATATCAATTTTTGGCGTTCGATTTCGACGAAAATGTAGAAATAACACCGGATAATTGTCGACTCCTATTGATAAGGCTAAAAATGGAAGGTTGGATAATAGGGAAGAAAAGAGTATTCCTCAAGTATTATAATGAAGAATACTTGGCAAGATTGTACGAATATCAAGTGAAGAAAATCATCAAGATCCAGAGTATACTCAGAGGATTTCTTGCTAAGTGTAGGATGAAGAAGGATGGAGCCAAGACTGAAGGAGTAGAAGAACAGACCGCAGAACCCGAATTGACAGAAGAAGAAGCTGCACAAGTAATACAAAAAGGTATCGAGCAGTAAAATCCGATGTACCTAATTCCTCAATATATTAGTATAACCCTACTCTTACGCTTCTTTTTTTGCGATCCCCTATTTAAACCCTTTCTAATCCTAGTTGTGTAAACTCTTCTCCGTAAAGACCTGAACTCCACATTCCCATTTACAAAAAAATTTCAGCATATAGAAGACGTGCCAAAACATATAGAAGACGTGCCAAAAAAGATCAAAGTGAACAAGGTGATGTGCAAGTTAGCAAGGATTTTAGCCTGGTCAAAAAATACGCAATGAGGTGGAAAAAAAGTAGTTTTCTCCATTTGTTATTCAAGATGAAATCGAAGAAAATTTTCGATACCTTCAATTTGAGTTTACAGATCTTTATTTTCAACCAAAAAGCAGTATTTAACTTGGATTCATTACTCACAGAAAATGTTGATATAACAGAAATTGATGCTCAAAGCACCAAACCACCTTGGAATGGAAAATTTACCCCATTGAATATGAAGATAAATTATAATTGGAATGAAATTCCTTTTTATGATGTTTCCGATATGGATTCAGACAGAACGACTTTGAGGTTAATCGAAGAGTACAGTGAACCTTGGGATATGCCGCTTCAATGGAGATGCCGCTCTACGAAAGAACACAAGGAAGCACACGATGAAAAGGCAGCAGAAGCAAACGAAAATCTGATAAACCTTCCATTCAGAAGAAACCCCGATGAAACCTTAGAGAAACTGAAGGAGACTGAAGAAACCCTCCCCGAAATAGAAAAACAACCACCAGAAAACCTGAAGAAAATGAAGAACACCCAAAACGAAATCACTTACAAGCAATTCAAAAGTCCCGGTAGAGATATTGTTTCGTTGACAACGAAACCGGCTGGTTATAAAAGCAATTTTGCCTTGGATAACACCCAGCCTGCTAATAAGGATTTCGATTACATCAAAGCACCAGCACTGAATAAAGTCAGAGGTCCAGATCCTATAACTGAACTCAAGAGCATCGGTAGGAGAGACAGTACCAATGATGACAGTCCTCCTTTCAATTTCCAAGGCATGTTGCGAAAAACAAACTTCAAGCGAGATTCTATGAAAACATTGGTCAACATTCGTCGTTTTTCTTTGAAATCTCAAGAGAAGGAATATTGCAAAGATCTTAAGGACAATTGCAAAAATGAAAATTGCGAAGACCTTGAGGACAATTGCAAAAACGAAAAGGAAAATTGCAAAGACCTAAAGGAAAATTGTAAAAATGAAGAGGAAAATTGCAAAGAAGAAAAGGAAAGTTGTGAAGACGGAATGGAAGTATGTGAAAAAGGCGAATATGTGAAAATGGAACTTGCACCTGGATTAGTCGTGGAAGGCACTGTATATGATATTTAAGTTATATTCTATGAAAATTACTTTTTCTGCAATAAATTGATCGAAGTTATAGCTAAAAATAGATTGAAAATGTTACAAGTAATATTATCATTAAATGCTCG
>TRINITY_DN73_c0_g1
AGATTCACTACTTTGTTTTATACGTTTGAAAGTTCTATTCATGTCAAGATAGATTAAAACAAGTGTTGTCTGGGCATGATTTTTTCAAACTCAATTGTGAAAACCATATATCGATATTAATCATGGATTCAGAATTACAGGGTGTTTATTGCAAGGATTCATCTTGAAAAAATTGCCATAACTCAAAATTTTGATTAAGTTATGTTGATGCAGTTAGAGAAAAAACATTATAGCTTTTTTAGGCCAAACATAACTCCAAAACGATGAAGGATATCGATGTACAATTTTCAAAATTGGGTTTTTCATAGAAATTGGTCGTCGCCATCAGTTTTGTCTATCTAGATCGTAAAAAGGACCTTCAATTCAATAAATCTGTCTGCTACCTAGATGTATCGAATTTGTTTATGTAGGGATATTGATGGAAAATCCACTGATTCACTAGCTATGATGATCGCTCATTAATACCATCGTGCTGTATCTCATATCGGTGATTTGAATGTATTTAATATGATGTAGACCCTTTGCTGAAATAGATATCACCCTGTATATTTATGCACTTTGGAATAGTACCTATTCTAAAAACAACTTTGAGATTCTAGTTACATATAAAATTATAAGGAATTTTTCAATTCGAAATTGCTAATATGTTTTAACCATGCAAAATAAGCCAGAACGAAACTTTGAATGAATATTCGAAGATACAGGGTAAGTCTTAAAGATATACATCTAATTTAACCATAGAAATATTTTTTAATTATATTATTTTTCTTCTTATAGTTTTCAAGTTACAGTCTCGCCATAAAACTGTTCGTTATTAGCATAAAGAAAGCAATTAGTGTGATTCAAAGTCTCCCTCAATATTTAACTATAATTTTTCCTTTCTATACGTTTCCCGTAAAACGCACCATTTTTGAGATATTTAAGGTTGGACATTAATAAATGCCTATACGTTTTTACCTGATCCAAAACAGGAAAAATTATAAATGAAACAAGAGAGGAATTTACAATTAAATTTAATGTATAACATTAAGACTCATCCTGTAGGTATATCTAAAAATTTGAAAAGTCAACTAATAATGTCAAAAATTATTAGTATTCGACTGTTTTTGAAGATTAGATGAAAAAATAATGAATGTAATATTGAAACTAACGTCCGACCTGATACAGAGAAAAAAAAGTTCTGAAAATATGTATTTCCTTCGGATGAATTAAAAATGATGAATTGTCAGAATTCTCAGAAAGTTTATCAATATAAAATTAAATGTGTTTTATGTCAAATGAGAGATGAAATGGAAGCTCTGGTACTTTCGCTGCGATATTGAAGATATACGCCTGAAGAGATAATTTTTGATCTAGTATTTGAAATATTCGTAACGTTGTCGAAAAAAAAAACGATTGACTGACTAGTTGTGAAAGTTTTAGTAAATTGATTTCAATTGAGAGATGTTGCTTCGATTCGATGAGTAGAATTGTACATTTTGTGATGTATTGTTTGTAATTTTATTGTAAATGTCCATTGGTATAAATTTAGTTAAGCTAACCAAAGATGTATGTATAAGTAAACCAATTGAAATGTGCATATTTTGTTCCTTTATGCAAGTGGAATTTAGTCTGGAATTGTCCTAATGATGTGTATCTGCATAATATGCAGTTACTTTCCTATCATGCATTTTATGGAAAATATGAACCACGTATAATATATTGTATTCATCTGCTG
>TRINITY_DN145_c0_g1
TTTGAACTTCCCTGTAATCCATCACATAGAATTCCCCAAAAGCGTGAACAGAGATGACCTTGTTATTGGTGCTGGGGCAAATGTTGGTGCTCTTCTAGTTGATGGTCTTGGTGATGGTGTACTTCTTGAAGCTGCTGACCAGGAATTTGAGTTTTTGAGGGACACATCCTTCAACTTGTTACAGGGCTGCAGGATGCGCAACACAAAAACGGAATATGTCTCTTGTCCTTCTTGTGGGCGGACACTCTTTGACCTCCAAGAAGTCAGTGCTCAGATTAGAGAGAAGACCTCTCATCTGCCAGGCGTCTCTATTGCTATCATGGGTTGCATTGTCAATGGGCCAGGGGAGATGGCCGATGCTGATTTCGGATACGTTGGAGGTGCTCCTGGGAAGATCGACCTTTATGTTGGCAAGACCGTCGTGCAACGGGGCATTGCAATGGAGGGGGCCACTGACGCCTTGATTCAGTTAATCAAGGACCATGGCCGTTGGGTGGATCCTCCTGTTGAGGAGTAGGCCGTAGCATGTAGTTCATATATGTACTCCTCCATAAACAATGTTGTAGCTGAGGCACATTGTATTGTATCCACGGAGTACATAAATACACGTTCTGTACATCAGTTTAGAAATAAAGTAGGAATAGGGGTGGCTGCAACTTTGTAACACCCTCGTGAAGCATCGGCAAATCCAAATTAGAAGCGTCCTGAAATCAGTGAAAAAGAATTGATACTGCTATTTTTTGTACCAATTGAAAAAAAAAAGGAATACATGATATGACTAACTCATGGGTTACATCTTCGTCG
>TRINITY_DN3_c0_g1
ATTTTGTGGAAGTCAGGTCAAAAGTCACAGTGAACATGTAAAAAATTTATAAGTGCTCCATAAACTCGAAAGAAAAATGGAATCGTTACATACTAAACTATTGCCTTATAAGGAATTGGTAGGAGGCATCGCTAGCGTTGTCACAATAGCACAATTCTTTTCTGGAGCTGTAATGTGCAAGGATATCCATAATAGGAAAACTACAAAGGGTGTAAGCGCAATTCCATTTGTGGGTGCAGTCATCATCGGTATTCTAGTTTTCAAATATGGTGAGTACTACTTGAAAGAAAAATGAAAAAATCATAAGCGACTGATTTCCAGCGGTATTCTAGTTTTCAAATATGGATTATTGCTTCATGATGATGCTATGCTTCGTGTAAATATGGCATCAGTGAGTTTGAACTTATGTTATGTAGCTGTTTTTCTATATTATTGTGAAAACACTTGGGAAGATGTATTTAAACCAGCATCATATGGAATTGTACTTGTTGCATTACTTCTTGGATATGCTGAATGGGAAATGCCCGAAAAAATTGAATATAGATATGGTCTTTTAGTCACCGTTCTCCAGCTACTGTTGTTGGCTAGTCCTCTGAGAGATTTGGCTAATATTATCGCCACAAAAGATGCCTCCTCTATTCCTTTTCCTATTGCATTTATGGCAGCTATAGTAACATTCCTTTGGTTTATATACTCCATAATTTTGAATAATATATTCATGCTGGTACAAAATTTTGTAGGCTTCGTCCTTTGCATTGTCCAAATATCTCTAGTGTTTATGTACGGTTCACATTTGGAAGAAGGAACAACGAGCTAATTCGAGAATATATAATAAGACTTTTTCAAATTGTGCCATGGGCTGTGAGTGATTTGTAATCAATATACCTAATTAAAGTAAATTGTATTATTTTTAACCACTTTCCACATAAAATTTTTCTCCTGTTG
>TRINITY_DN0_c0_g1
TGCCTATTTATCTTGAATAATTTCAAATTAAAAATTACTGTGATAATTTTTTTCACATGTCAAAATCTAACATTTTGGTTGATTGAACTAATAAAAATGTATTATTCCAGCCAATCATTCGGGATTATACTGATAATACTACTTCCTCATCGATAATACCTTGTTTACATTGAAACGTCCAAATTTTACTTTGAATTCATCATTATTGACAGCTTGAAGTGCAGTATTGAAAAATTAACACAAACCGATTCAGTGCTTTCACCCAACTGAAAATTGACATTTAAATTGTAAAAAAAAATA
>TRINITY_DN146_c0_g1
AAAAGGTTCGTGACCCAAAAGCAATTCGCGATGCCTTTGCAGATCATTTCAATAAGAATAATAATAATCGTAAAAAGCGATCGAAGGCCGTCTACTTCACGACACAGAGGAACCCATGAATGACAAACTTATGTTCTTTGACTACACTAGCAAGAACATTGTCAGGACCAAAGCTCAGCTTATTTTTAAGTTTTCCGGCTTCCTTGAGTATCTGTTCACCTGTAATCTCCTGAATATGCAGATATCCAAAGGGAA
>TRINITY_DN74_c0_g1
CATAATCACATAAGTAACATTTAAGTATATCTTTTTCTATTCAATTGGACAAATCCATATTAATTTTGAGGTAAACTTTCCGGTTGGCTACATAATCACACAGGTAATTATTTTAAGTTCAAATGGACAGAATCTATATGCCTTCTGAGGTTATTTTTCTGATTGGCTGCATAATCACATGAGTGACATTTATGTTCTTTTTTATGACATTTATGTTCTCTTTTATTCAAATGGACAGAATAGATATGCTTTCTGAGGTTATTTTTCTTGCTTGCAGCATACTCACAGTTTATTTAGTGTATATTGTATTCATAAGAAATCTACTAAAAACTGATAACATCTATATGCTTTTTGTGGTTATTTTTCTGACTGGCTGCAAACTCACATAAGTGAATTCTTATAGCTAAAGTTTTGAAATATTTCAATATGATGGATTGTAAGATTTCTAAAATTCCTGTACAACCAAAATTAAATTTAACTAAAGCAGACGAAACTAAAAATTTCAAAGCACCCTATAAAGAACTCATTGGAAGTCTTATGTATGTTATGTTAGGAAGTCGACCAGACTTATGTTTTGCTGTATGCTATTTTAGTAGATATCAAAATAGTTATGATGAAGAACATTGGCAATATTTGAAAAATGTACTTAAATATTTGAAGGGTACTGAAAAGTTAGGCTTAACCTATTATAGAAGTTCAACTAATGTGAGAATATTTGCTTTTGTAGATTCTGATTATGCTGGTGATGCTAATGACAGGAAGAGTACAACGGGTTTCTTTTTAAAGATAAATACCAATACTGTATTCTGGAATTCTAAAAAGCAGTCACTCTGGAATTCTAAAAAGCAGTCAGTTGTTGCTTTGTCAAGTACTGAAGCTGAATATGTGGCATTGGCATCATGTGCAACAGAATGTTTATTTTTGGGACATTTATTGTCTGATTTAATTCTAAATGATGTATATCCTATAAGAATTTATGAGGATAATCAGTCAACAATCAAAATGGCTCATACTTATGAAACGAAAAGATCAAAACATATTGATGTGAAATATCATTTTATAAAAGATTTGGTTAGTAGTAAGAAAATTGAAGTTGAGTATATTTCTACTGAAAATCAAGTTGCCGATATTTTAACAAAGGCATTGTGTGTAAATAAATTTATTTCATTTTGGGATGCACTCAATGTGAACTAATTGAATGTAATATGTTTATGAATTAGAAGTTAATTTTTTAAGTTCATGGTTAGATTGTAGAATTGAGGGAAAGTGTTGTTATATGCAATTCTATGTAACAGTTGGTAACACAGTCATTGAATGACATTATAAATGTCAAAGAGATATATGTTCTATGTCTAGATAACCAATTGATACTGTTGAAGAAGTTGATGTACCGATGTAAGATTTTGCTACAAATAAATCCTTGTGAATTGAAACCATCTTTATTTGAAAATACAAATAAACACATTCACGCAATAGTGAATTCTAGACACATAAGTGACATTTATGTTCTTTTTTATTCAAATGGACAGAATCTATATGGATTTTGAGGTCATTTTTCTGATTGGCTGCAAACTCACTTAAGTGACATTTATATTCTTTCTCATTCAAATGGACAGAATCTATATGGATTTTGAGGTCATGTTTTTGATTGGCTGCAAACTCACATAAGTGACATTCATGTTCCTTTTTATTCAAATGGACAAAATCTATATGCCTTCTGAGGTAATGTTTCTGATTGGCTGCAAACTCACATAATATGTTCTTCCGGTTGGATGCATAATCACATAAGTGACATTTATGTTCTCACATAAGTGACATTTATGTTCTCTTTTATTTAAATGGACTGCATCTATATGATTTTGAATGGTTCGTTTCTTGCTTGCAGCATACTCACATTTATGTTCTCTTTTATTCAAAGTGACATTTAAATTCTTTTATGTTCATATGGACAGAATCTATATGCATTTTGAGGTAATTTTTCAGATCGGCTGCAAACTCACATAAGTGACATTTATGTTATCTTTTATTCAAATGGACAGCATCAAATGGACAGCATCCATATGATTCTGAAGGGTTTCTTTCTTGCTTGCGGCATACTCACATAAGTGACATTTATGTTCTATATGAATTTTGAGTTGAACTTTCTGGTTGGCTGCATAATCATATAAGTGACATTTATGTTCTTTTTTATTTAAATGAACAGAATCCATATGAAATAAATGAACAGAATCCATATGAATTTTGAGGTAATCTTTCCTGTTGGATGCATAATCACATAATTGACATTTATGTTCTTTTTTATTTTGAACTTTTTGGTTGGCTGCATAATCACATACGTGACATTTATGTTCTTTTTTATTTGAACGAACAGAATCCATATGAATTTTAAGGTATTCTTTCCGGTTGGATGCTGAACAGAATCCACATGAATTTTGAGGTATTCTTTCCGGTTGGATGCATAATCACATAAGTGACATTTATGTTCTCTTTCATTCAAATGAACAGCATCTATATTTTTTATTTGAATGAACAGAATCCACATGAATTTTGAGGTATTCTTTCCGGTTGGATGCATAATCACACATTACATAAGTGACATTTATTTTTTTCTTTTATTCAAATGAACAGCATCTATATGCACTTCGAGATTGCTTTTCTGGTTGAAAGCAAATTCACCTGTTTCATATTTGAAAGACAATCTTATTCCATTCTCATCAGTGTAATGATGAACAATATCCATGATTTCATTCTTTATTTTGAAGGGTAAATGGACTGCATCTATATGATTTTGAAGGGTTATTTTCGTGCTTGCAGCATACTCACATTAGTAATTCTTTATGTTCAAATGGACAGAATCTATATGCAAATGGACAGAATCTATATGCTTTTTGAGGTGATCTTTCCGGTTGGCTGCATAATCACATAAGTAACATTTAAGTATATCTTTTTCTATTCAATTGGACAAATCCATATTAATTTTGAGGTAAACTTTCCGGTTGGCTACATAATCACACAGGTAATTATTTTAAGTTCAAATGGACAGAATCTATATCGTTTATTGCTTGCAACATACTCACATAAGTGACATTTAAATTCTTCTATGTTCAAATGGACGGAATCTATATGCATTTTGAGGTTATTTTTCAGATCGGCTGCAAACTCACATAAGTGACATTTATGTTCCTTCTGAGGTTATTTTTCTGATTGGCTGCATAATCACATGAGTGACATTTATGTTCTTTTTTA
>TRINITY_DN125_c0_g1
GATGAATCTTTATGTGTCTTTGTCATCCGACCTTTGCCATGACAGGTGCGCTTGCATGGCAGGTCATCGAAAAAAAATAAAATAGTATTATTTTGGTTTTGAGGAAGAGACCGCACGGGATTTGCCCGGGGTTTCTTCCTCGCTGGTGTGTGTTTTCTTCTCGTTCTCTCTTACTCTCAGTTCGTCTCTACATCTTCAACCGCCATCAACTGCTTCTCGGATTTACCTGATTTCCCGCCGTTTATGCCAAGGTATTTTCTGACGATTCTCTTACACTTTTACCCAACCATAAGAGAGGATGAAAAATAATTATTCACACATCTGCATCCATACTTAAATCTGCTAACGTTCATTCACACACACAACTGCATCAATACTTAATAACGTGCTAATTTATTCACCCAATTGCTCATGTTTTCTTATTTACAATTAAC
>TRINITY_DN80_c0_g2
GTAATCACATATTAATTACTGCACTTTATAATATCTTCTGAAATATGCGAGAATTTTGCTTCTTTACATAGCCACCGTGCTCAGTCTCTGAAGAAATTTCTCTGCGGAAAACGGTTACATTGTTCAATAGAAAATCCATAAAATATAATATAGCATTCCAATATCCATCTTCCTTCTCACAAGAGCAACACCTCTTTATCACTTGTGTCTCTTAAATTTTTTTCCATTTTTAGCTGTTGGTTTTCTTCTTTTTCGTGTAGTAGAAGTGGTTTCTTCAGTCGTTTCGTTCGATTCGGAAGTAGTTTCTTTAGTGGTTGTTGTACTAAGGGGTTCGTAACTTGGTACCATTACAGGATAACAAATTAGCTGACAATTCATAAATTCCTGGTAATGATTTCTATTTCTTCTCGCACCGTAATTGCTCTTGAAAATTGATTGGTAATTGTATATTGAAGGTTTTAGAAATCCAGGATCTAATCTGTATTTTCGTTTGAACATATTTCTGTAACAGCTAGCGATGTAATCTCCAAAATCACCTGAAAATTACAATTAAGGAATTAGACTTATAAGAGATTCGATATTCTTCTATAATTTTCTCTTGGGAGTCCCTAAAAAGCATGTTTAAATAGCTATAACTGCTTTTATTACAAATCATGTATTTTCAAAACAAAACTTGGAAAATACTTCGTAATCACATATTATTAATACTGCACTTCATAATATCTTCTGGAATATGCGACAATGTTGCTTCTTTACATATAGCCACCGAGCGAAAAATGTGCTCCGTCTCTGAAGAAATTTCTCTGCGTCAAATCATCATTCAAACGTTGTTGTTCAAGCCTCCAATCGGCATATATTCTACGCATTCCATGGGTAGCATGGTTCTTGTGTCAACTGAATATATCCTGCCATTTTTTAGTTCCTTGGTCCTTCCGTTCAAATTTTATATGTAATTATAGAGATAGAATCGAATTTGAGGTTGGCGTTACCATTCTATTCAGGAAACAAATCGTCAATTGCAGTCATATTGTTGTTCAAGCCTCAAATCGGCATATGTTCTACGCATTCCATGGGTAACATGGTTCTTGTGTCAACTGAACATATCCTGCCATTTTTTAGTTCTTTGGTCGTTCGATTCAAATGTTATATGTAATTATAGAGACAGCATCGAATTTGAGGTTGGATTTACCATTCTATTCAGGGAACAAATCGTCAATTGCAGTCATGATCCTTTTCCTTGAATCAAATCAAAATCTTTTCCTTGAATCAAATCAAAAATGTTGGGTATTCAATGGAAATTGGAGTTCGTTAGTTGGCAAATTCCGTAAATACCTGTAGTAACTCTGAATACCGGAGAGGTTGCGCTACTGACTTCGCGTCGCAGCCTAGCGCGGCACCGGGTCATAATGCTGTGCCCTACGTGAGCGAACTATTGCGAGCGATGCGAGCGACGCGACCAAAGCGAATTTATCAAACCTTGGAATATAATAGCGCTGTCCTACGTGCCTTCGTATCGGTCGTAAAACTGTTGAATGCGAAATTCGCGCGATCAAATTATTTGATATTTGCGC
>TRINITY_DN7_c0_g1
ACCGACGATTGATTTGGTTTTGCAGAACAAGAAAGTGATTTGGAGCATATTCGGTGCGAACTCGATGGTACAGGTAAACGACGATGTATTGTGCTTGGGATTTGTAGACGGAGGGGTTGATGTGAGAACCGCGATTGTGATTGGAGCCCACCAGATTGAGGACAAATTGCTTGAGTTTGATTTGGCAACTTCTAGACTTGGCTTCACCCCAACTTTACTGGGTCGGATGACTACTTGCGCTAATTTCAATTTTACTTCTAATGCTTCTTGATTAATTAAAAATAATCCCAAGTTTTTAATTAATCATATGCTTAAATTCCCATTAAATAAAATGTTGTTGCTTTTTACATTTCTGTATTGTATTCTATTTTTATACTTTATTATTTAATAAGTGAGAGCAGAATTTAGCTCAACTCTATTGGGACGGATGACTACTTGTGCTAATTTCAATTTTACTTCAGCTGCTTGATTAATTAAAAATCTTTAACCCAAGTTTTCTATCAAATCAAATAAATGTTTTTACCACTACTTGTGTTGAGGTTTTGTATTTTGTAATTTTAATATTGAATAATTGAG
>TRINITY_DN47_c0_g1
CCGAGAGGTCCCCGAGCTTTTCGCCAAATATTTTCGTGATGTTTACGTCCCGCCTGTAGAGGGAGCTCTCCCGGATACCGAATGTCCCAAAATAAGTTATGTCGAAAAAATAAATTCTCGAACGATAGAGAATGTAATAAATGAATTGGATATATCCAAGAGTAGTGGTCCCGACGGCATACCACCATTATTTATAAAAAAATGTATGAGCAATCTGATTAAGCCACTTCAATTAATATATAATCTTTCACTCGAAACCGCATCATTTCCAACTAGGTGGAAAACAGCTGAAATTTCGCCTATCTTCAAAAGTGGACAAAGAGATAACGTTGAGAATTACAGACCTATTAGCAAATTATGCATTTTCGGCAAACTACTTGAAAAAATCATATATAATCGTGTACTACCCTCAGTGAAAAATATTATCATAGAGGAACAACACGGCTTCTTTCCTGGGCGATCCCTAGAAACTAATCTTCTTTCATTTTCGGAGCATGTCAGGAAGGAATACCGACAAATTTATTAATTAACATCCAAAGGTGCTGTATTATACATTATACTTCTTTCTTCTTTCATTTTCGGAGCATGTAATAGAACAGATAGACGCCCAGGGTCAGTTAGACACGATATACACAGATTTTAGTAAAGCGTTCGATAAGATCAGTCATGAGAAATTATTGAGAAGACTCGCGGATGTTGGCTTACCCGAATCGTTGGTAGAATGGTGTAAATCCTATTTAACAGGAAGAGCTGGCTTTGTCGCGATAGGTGGCCACAGATCTGAAACTTTCTATATTACATCTGGCGTTCCTCAGGGTAGCCATCTGGGTCCTCTATTTTTTCTTATTTATATTAACAATATCAAGGGTTGCTTCCGACACTGTGGGATACTTCTTTATGCGGACGACTTGAAGATCTATCGGGTCGTTCGATCGATGGGTGACTGTCATGGGGTTCAAGAGGACCTCGATAGATTGGTCCAATATTGTGAACTCAATGATATAGTTCTGAACCCGTCGAAATGTTTTCATATTTCATTCACTAAGAGAGTCCAAAAAATCATATATGAATACAAAATTGGAAACGAAAAGTTGAAATACGTAAGTGAAATTGTTGACTTGGGTGTGACGCTTGATGAAAAATGGTCATTTCGATCACACATCGAAAAAATGATTAGCGCGTCAAATAAAATGGTTGGATTTATCAACAGAAGTTGCAGAGAATTCAGAGATCCTAGAGTCTTTACTGGCTTGTACTACGCGTTTGTGCACAGTAAGTTGTCTTTCGCATCCGTTATCTGGAATCCTATTTACGAGGTTCACATAAAAAGAATCCAGAGAATTCAAAATAAATTCCTAAAATTTTTAGCTTTCAAAACTCATACCATCATAGAAAATAGAGATTATACCCCTATAAGAAAAAAATATCACATGTTAGCTTTGAAG
>TRINITY_DN21_c0_g1
AAACCATCAATAGTAAATTTTGCTTAATGTTATTAGATCAATTGAGTGCAGAAATAAAAAAACGTCCTCAAATGCAAAAGAAAAAAATTCTCTTTCAATGCTCCTCGTCACAAACCAGATGAAAACCATGGTCAAATCGAGTGAGGTGTTAAACTATTTTCCGTTTTATCTGCGCAGATGAAACTAAACATACCCAGCTTTTCTATTTACAAATCTTTCTTTCTTATCCATGCCTCAGATACACAATATAACATTAAGTGGATACACCAGTTCTAATTGAAAATCATTGTTGCGTGGGATAACTCGACTTGTTTTACGCTTGGAAAATCCTTCTTGTATATGCAAATTAAATTTCTCCTCCTTGGTTTATGATGAGTCATATAGGTAACATTGTAGCATGCGTATGCTATTATTGACTTTCGTTGGATTACATTGTGAAAACAATGATGAATATACAATGTGTTTTTCCGCTTGAAAAAAAAAGTTTTCCAAGGAAACTAATTTTTCGGAATTTACCTTTGCTCTTATCTTCAAAATCATTGTAAACATACAGAACAGGAACTCAATAAAACCTTGTTTGGTAATTATAATGATTATAAGCTTCATATTTTTGGGATTGTCATGCAATCGAATATTACATTAAATATTCCATATGAAACTCAAAATGATATTCCTTGAAAT
>TRINITY_DN35_c0_g1
AAGGAAAACAACAACAAGAAAATCCAAGAGGTGCAGAGAAAACTGATAATTTAATTTTGCAACTTAAATATTTACAAGAATTACTAGAAGAGACAAGAGATAAAAATTACGAAAAAATGAACTCGTAGATTTAATAATGAGTGCTACATTACCTGAATATGTGGCAAATGGAACATTAATTAACTTTGTTAAAGAATTCAGGAAGAAAATTCAACTGAATGAAGATTTGAATAAACAAGATGAACAACAACAAGAAAATCCAAGAAGTGCAGAGAAAACAGATAATTTAATTTTACAACTTAAGTATTTACAAGAGTTACTAGAAGAGACAAGAGATAAAAACAACATCTTGAAACAAAATAATGGTTTATTACTGGAAAAAGTACAATATATGGACATCCTGAAACAAAATAGTTGTTTACTACTGGAAAAAGTACAATATATGGAAGGAAAAAGTCAAAAATCAGCAAAAACGCAAGTAAACATTCAGAAAAAAGTATCACCAATTCTAATTCACA
>TRINITY_DN153_c0_g1
GGAAGAGCCCAGTCTTTCCAAACCCGACTGTATTCCCCAAGTGGGCCAGTTCAATTATTCCAGGTGTCAGTGTTGAGACAGAGTTCATGAAGGATCTCAGACTTATGTCGTTTGAAAAGAGCAAATCCCGCCCAGCTCATTATGAGTGATGCAAAGCTCGGAGCCCTCATCGAGAAGAATTCACCATACTGGCTCCAGAATTACCAAATCTGCAAAGCTCTCGTAGTACCTACGGACTCTCTTCGGCGAGGTCCGACAGTGGTGGCAGCTCCAGAATTGGTGACGAGGAGGCCGCTATTTGGAGAAGTACCCTGCACCACGACTCACCCAAATCGCACAAAGAGGACTCCGAGCCAGAAAC
>TRINITY_DN160_c0_g1
GTTCATTCGTTTTCTTTCTCTCCGGCACTACTGCGGTAGCCAAACCCCCTCTCGCCAGACACCTATCACCACCTAACAACCATCTTTGAGTTTTCTCTTTACCCTTTCCTTCTCCGCTGCCTCCATTATCTGTCGTCAGCACGCTTCAGCAGTCAATTTTCTCTATTTCTCCCTTGTCGCCGGCACGCTGCTACCAGAACCTGCAGAACTCCATCTCGAGGTTGACACAGAACTCCAACTTCAACCATGTCCGGGGAGGAGGAAGAAAATGCTGCTGAGCTTAAAATTGGAGATGAGTGTTGGAAAAGTCACTTCAATATGTGAAACGCTTTAGCCGTTACAAGAATCCCGATGCGGTTAGACAAGTTCGAGAAGTTCTAAGCAGGTATCAGTTGGCGGAGTTTGAGCTTTGTGTTCTTGGCAACCTTTGCCCTGAAACTGTGGAAGAAGC
>TRINITY_DN154_c0_g1
GGGATCTGAAACGGATAAAACAGATCAACTTAGAGATAATGCGAGACAAGACAGACAAGAACTTCATTCCGTACGCCAAGGCCAAGGCTGCCGTACGAAGAGTGTTGGCATCAGCACCCCATGAAAAACCTGCTGATTTTTGAAGGATATTATTTCTCAACTTCAATTTCAAACGTAAATTTTCCAAGTGAACATTGAAAAACAAAGAAGAATAGGGAGTGTAATTATGATTCAAGACGGATTTAACCAGAATCCAGTTATTTTGTGTTTTCTTTGTTCAGCATAGACACAAAATACACAATAAAAGATCTTTACTAAAATTTGAC
>TRINITY_DN113_c0_g1
ACCATACAGTTCCAGGACCAGTCGACCTGATGTATTACTGTTAAAGAAATATCAATTCAGAATACTACGGAAGTACCTATTGAGTTTCGCATTTGCATTTTGAATGATGGATCATTCGAAGCTATCACTTGGGTGAACTTTTCAATGACTCACGATGAGACGAAGTATAAAGATGCGCAAATGCACAAAGATTACCGTCTCAAATTGAAAGACGTGAACGAATACGAAGTTTTGAGGAATATTCAGAAGGAAAACCCAAACATAACAGACGCCGATCTACACAAAACCTTTTTGCACAGGATATACGAAGATGAGTTGGCAGAATTTGACTCTACTGATCAGTTCCTCTATCATGACCCAAATTTTAAGTTTACGGATACTAATGGTGTCATTGGTCCACACAGTGTAGTCAATATCGAAGTGGTTTTCTGTCCCACAGAAGCAACCCATTACGAAAGTGTGGCTTATCTAGACGTAACTGGAAGAGAAACCCGTCAACCACTGAAAATGGTTGGAACTGGTCTCGGTCCGGAAGTGTGCTTTAACTTTAAAGTTTTGGACGTGGAAAATTTATATCTTTGCGCGAAGCATCAATATGAGATAGTAGCCAAAAATGAAGGTCACATACCCGCAACTCTCACTTACTGTCACAAAAACATGGACTTTGGTGGCTTGATGTCTTGTTCGCCAGACGAAGTCCACATAAAGCCTGGAAAATGCGAGAAAATGGTTCTAGAATTCAGCTCAACTATGCAGGGGAAATTTTTGGAGAATTTGAATTTCCGAATAGCTGAATCTGGGGAATATGTCAATTGCGTATTTCAAGGAAATGTTGTATGTCCCTTGCTGAGTTATAATATAGAAGAGATTGATTTTGGTATAGTAGCCTTTGGTTTTGCTGTGGAGAAAGAAATATCAATTCAGAACACGACGGAAGTTCCCATTGAGTTTCGTATTTGCATTTTGAACGATGGATCATTCGAAGCTATTACTTGGGTTAACTTTTCAATGACTCACGATGAAACGTCAGTTAGCAAAATGCCTAAAGAATTCAGTGTGAGCAAAATGCCTAAAGAATTCAGTATATGTCCAGATGAAGCTACAGTTGCAGGGAATTCTTCTATCACGATAAAAATCACTTTGGTACCAAATAAGCCTTCAAGACATTCTACATATCTGCATACCTATATGTGGGGCTCTAGAAAACATTATGTAGAACTGCCCATATATTACAATTGTATAGTACCTACCGTTGAATGTTCACCACCTAGATTGGACATAAGATATTGCTTCATAAACTGCCCTTACGACAGAATGTTTACAATCAGAAACATGAGTGAAGTACCTGGCTACATACTCTACAATGATACGGACGAAGATGATGGTCTCTCCTGCAAGTTATCCTTAACAGAATCGTACATTCAGCCTGGAGAAGAAATAACGATTCACCTGGAGATCAAGGGACTGCAGCTAGGACTTCATTCAAAGCACTTAAATTTTACAGTGTTTGGCAGTGCTCCCAACGATCTTTGTAAACTGACATGTGACGTCCAAGGCCCTGTGATTTGTGTGAATCCCGAGGAGATTAAATTCAGCCATGTACCACTTCTCAAATGGCACTCACGAAAATTGAACGTCATGAATGATTCTCCAGTACCAGCCTATATATCAATTCAAGTGGCCAATCCGACTTTTCATGTGAATCCCAACGAGTTCAAACTGGAGGCTTCTGAGAAATTAGAAGTGGACATTTCCATCTTCTTGACCTATATCGCGAAATACACGAGCATCCTCATTCTGAACATCGTCAACAGCATGGACCCCTTGAAGGTTCATGTATCGGCCTTCGGAATTGGATCTTGCATACTTTTCGAACCCATTTTGGAGCCCAAGTACGACTTGGGAACTCTTATGACACACAACAGCTTCAAAATACCTTTCAAGATGACAAACATGGGTAGAGACTTGCAGAAGATCTACTTCTCCAGAGTGAAAGATATGAAGAGTATGAAGGAGGATACTCCCACTATGAAAGGACATCCCTTCATGATTGACCCTAACCAGTTCGATTTTATGGAGAAAGAACAGAAAATAGGTTACATCGACGTATACCATACAGTTCCAGGACCGGTCGACCTGATGTATTACTGTTATTCGCTAGACAAGACGACTAAATTCACAAAAGTTTTCGAAGTGAAATTGTTCGCTCAATTTGAAGACCCAGTACTGGTGTTATCAAATTCATCGCTTAATTTCAGGATGGACGTTACTGTCGATGAAACCATCTCTCATCTTCAAGAAACCTTCACTATACTCAACGAATCATACCTAGCCTTGGACATCTACGTCAATCTCACCCCTCCATTTTATATTCTGGAAGAAGAACAAGGAGGTAGAATATCAACACTGAACGTAAATGTGGCCAGCAAGTCAGAGTTTTTCTTTGTCGTTGAATTTGTTCCCCCTACTGGCGTTAAGAAATGTTTGGTAGCTAGCGGGACTATGAAGATTGGCTTCAAACTCCATCCGAAAACCTTTATGATTCCCTTAACTGGAGACATACACTATCCAACCTTGTTTACATACCCAGAAGCAATCAGGAACCATAATATAGCACCTATGGCTAACTGTAGCAGAGAAGTCATCATCAAAAATATCAGTCCACTGCCTGTAGCTTACCAGTACGAGTGGGAAGTTGTATCTTACACGCTAGAAAAATTGGAAACACCAAGATATAACCTCTCATCCTTGGATAAAGCGACCAGCTGGAACCTGCAAAAAACGGAGGAATATCCTGACGTAGATCCCACTAAAGAAGAAGAAATCAAGCAGATCATAGAAAATCTAGTGCGGGAAAATCATTCTGACGAATTCAAACTACCAAGGTACTCGGATATATGCAACATTTTCCTGGAAAACGTGCGTTTTCCAACCATTTCTCCAGACGTCAAGAAAAAACTGTTGTACCTCTGCAAGTATCATCTCTACCCCATTGCACAGAACGTATCTGAAGTTGAGGAGGATTATCTCAAGATTCTCGAGGATGTACCAGGCGCCAAACCCGATATAAACGAAGCTATGCTGAACATCACACCGTATCAAGGCTGTCTTCAACCTTACGAATGCAGCCTGGTCAACTTTTACATAAGACCCCCGTTGCAAACGTATCTAAAGGCTACCGCAAAATGCAGAATACTGGGTGGTGCTGAAGAGAAGATAGAGGTCTCTGCTGTCTGTGGAGATATTGCCTACGATATTGATAAAATGAGTGTTTCCTTCGGGTATCAGCTGTTCTGTGAACCATTAGAAGAACAGATAACCCTCACCAACACTGGACATGTTGGTTTCGAGTATATAGTGCAAGACGATTCGAACCATCCAAAAGCCAAAAACGACATAGATGTTACCACAGGATTGTTAACTGTCACTCCAAACATCGGTGCTCTAGAGCCTGGTGAAAACGCTTTGCTACTAGTGAAATATTTTCCAGGAATCACTGGAGATTTCAATGAATCCTTCGTTGTAGAAATTGGTTATTTGAGTCCCACATCTATCAGAGTGAGCGGAACAGCTGTATACTCCCAACTATATATTATGCTACCACGTCCAAGTTTGTTCGAAGCTGCTGAGGCGTTTTTATGTTACACCGCTATAGGATACTTATCCAGGGACCTGAGTCATCTGCATTACAACATGAAATGTAGCTCAAGTGATTCCAGACTGGATGAAATTACCACTGCTATCTTGGAACAGGAAGATTGGTATATTGTTGAATACGATGACCCCAACATTCCATCTGCAGTAGATATAGACATGGCCATCGAAAGGATGATTGGTCACGAATTTCTTCAGAATAATCCCCAATTATTGGGAGAAAGAGTCAGCATCAGGAAGAGGCACTTCACGATACCAAATTACTTGGTGCCAGCTTACGAACTTTGCTTTGGTAATGTCAGACGTGATGGGCAGTACGAACAGAATGTTACCCTTTATAATTACGGTCCTGGATTGTGTCTGCTCAGGTTGTTCATAACGGACAAGAAAACTATTGAGGGAAGAGGATTCTTTGTCACGCTGGACTGCCAGAGGATTAAACTGAGAGAATTTTGCACTTTGAACGTCAAGTTTCGACCTGATGTGAAGGGTGCTGATTTTTCTAATCCCCATATATCGGAGGTGTTTTATATCGAGGTGAATCAAGGAGCTCGAATTCCTATTAAAATAAGTGCCTCGGTAGGCATTCCCACCACAGAGCTCAATAAACATTGTATGGATTTCTGTGGGGTCATCGTAGGTAGTTGCAAAAGGAAAATATTGTGCCTCTACAATGTAGGGTTCGTTGATGCCAAATGGAGCTGCACCATAGACACGCCGATATTCTTCGTCAGGAAAAAAAGAAGGCGTTCTATCTGCTTTCGTCAGGAAAAAAGAAGGCGTTCTATCTGCTGGCGAATCCGAAGAGTTGCAGGTCTTCTTCGAGCCGAAGACGAGAGGTCCAAAACAAGGAATCATGACTTTTCACGTTGAGGGAAATCATGAAGACTTGACCGCCTACTTGAATGGCTACGGTCGAGAACCGAATTTTGTGATCAAAGAGAGCCTGGTGCAGTTCCCTCCTGTATTACAATACTCTCCCCCCTTGGAGGAATCGTTTTTCATTCAGAATGCATCGAGTTTTCTCACAGAGATCTTCTTGTCCGACTACGATAGACAAATCGATCTGCATGAACGTATCTGCAATGTATTCTGGAGAGAGAAGAATGCGAAAAAAGTATATATCGCGAGATCTCTTTACAGTAGCACCCCCAGTGATATATACAGGTTCCTGTATAAGGAACTGCTTCTGGATAGACTCCGGAAGGAAAAAAGTTTCACTGAAGTCATGAAAGTATCGAGAACTGATATCAGGGGGTCTTCAGCATCTGTCGAACGTCTTCTAGATAATTTAGAGTTAAGAGTTGATAGTTCCATTGCGAGGAAGAAACCTGCTCAGGATATATTCCTGGATCCGAATATAGAGGATGATAAACCTACAGTGCAACGTACAACGAAAATTATCGTTTTTCACGGAAACAAATACACAGATTTCTTAAGAGCAGCTAACCACACTTCACGGATTTTGCATATCCCAAGGTACAACTTGGATACAATGATTGTCGATATATTGGTCGACAATAAGACTGCTTTCTCTATGGAGGTCAATCAGATTTTAGAGGATGCGTATATGTTGAGAATGGATGCAGAAGACTGCTGCTGCAGGGAGAGTTTTATAGAAGATGATACTGACTCAATATGGAGAAAAATAAATGCCATTCTAAGCATGGAACCTGCTGTAAAATCGCCGCCACCGAAGAAAGGTGGCAAGGATAAAGCAGACAAAGATGATAAGATGAGTACGGCTTCCAGTAAACTATCGAGAAAAACAATCTCGAGTAAACTATCGAGAAAAACAATATCCAGCAATACAGCCGACACATTCCAAGGAATACCAGAAGAAATGATCATCCAGATACTCTCCGATAAAATCGATCAATTGGACAAAGTGATCCTCGAGAGCCTAGACAGTATATTTCTCCCTAACTTACAAATCGCTCTGAGATGTTTACTGAAAGCTGCCAAGGACCTGTCCTGCGTCTACTTCGTATTGTTCAGTTGCACTTTGGAAGAACACAACGCTTTGGAAACTGAAGAACAACTTCTCAACGCCTCAGAGGAAGCTAATAGGAGACAGGCACTTCACAAGAAACTCACAGATTTAGATGACTACTCTTTATGTACCCAAGAAGAACGTGATATTTTAATGGAGATCCTGGAAGAGAAGAGAAGAAGAAGCGACGGGAAGAGAGCAGAGCTGAGGGAAAGAATCCAAGAAGATTTAAATACAAGTGGTCGTCTTGAAAAATCGGATGATCTGAAATCTTACTGGAAATATCTGGATAACTCTCTCTCAAGGAATCTCGTAACAAGTAAAACAACAACCAAATTTCCAAAAGGGAATGAAACTCATCAGACACAAAGTGGGACTATATTACCCAAAGAATCCAAAGATGCAAAAGGGTCTCTCAGAGCGAAATCTTCAATTAGAATGAATAAAAAAGTCGTAGAAGAGCAAGAGGATGAGGTAACAGCGTTCTACTTCTACCAATTCGACATAATGTTGAGCGAAATGTTGTTTCTTCTTGAGAACTGGAATCGAGACACTCTAGAAATGGAAAAACCTTTCCCGAACTTCGCCTCTATAATGGCAGCCAACAGAAAAGATCCAAAATATAATACGAAGGAATTTGTGAAAAAAGTGTCTAAGGTTAGAAAGTCGGTGGCCACGGAAAATGAGGATGTACTACCAGATAACATAGACGAGAATGAAAATGTGGTTATTACCTCTTTCGATCCTTCTATTGGTTATCCAGTGTGGATGATCAACCAAGCGCACTATCCTGTGTGGATGATCAACCAAGCGCATAAGAAGAGATCACTTAATTTAATCGAACCAATCATAGGTTTACTCAAACAGATGATAACAATAAACTGTTTGACTCCTATCAGAAATGCTTGAATGATAACAATTAACTGCTTGACTCCTATCAGAAATGCTTGTAAAGAAACGGAAGTTGTGTATACCGTTTTGACGAAACCTACACAAAGGAAGACGAAGGAAAAATTAGAAGTGTTCGACCTCGTCAAATGTGAACCTAGGGGCGAAGTTTTGCAACATGAACCCCCTACCACCAGGGGCGAAGTATTGCAACATGAACCCCCTACCACGGCTCAAACGGTTGAAGATGATATGCAGGTTGCCAAAAATTCGTATACCACACTAAGCAACAACTCAAGTTGCCAAAAATTCGAATACCACACTAAGCAACAACTCAAGGAAAAAAGCTAGAAGGAGAAAACTCACATTGACGCCAACACCAAGTGAAATGGACCAACTCAGCAGGAAAGCTAGAAGGAGGAAACTCACATTGACGCCAACACCCAGTGAAATGGACCAACTCAGCAGCCTTCCCGTCAGGTTTTCATTGGAGCCTGGTTTTATTCAAGAGATAACAGCCATCTTCAAGCCACTCTACTGCGGGTTTTTCAAAACCTCATACAGTTTCGAAGTTGTCGGCACTGGTTACAAGGAGAAGATTCTGGTACAAGCAAGCTGCGACTATCCAAGGATAGATACATCGCCCTACACTCTGTTTCCACACAACGTTCAGAGCATAGATTCCAAAACTATGTTTTTGAATGGGGTTTATGTGATGTCCCAACAAACGTTGGACTTTGGTACTATCCTTCTTGTACCCCAGCATTTACTGGAAATGAAGAGCTCAATTTCTATGCTGAACACTTCGGGTATGATGTGTTATATCAGCATCGCATTCAAAAGTGATGAAAATGTGTTCTTCATTGACGAGGAGCAGAAGATTGTTGAAATCAAAGCAGGAAGACAGCACGTTCTGCCCATTTATGCCAAACCGCCAGCGGAGGGCCTTTTCAGAGAGACCCTACTGATCATTATAAGGGACAATCCGAGAGTACAAGAAGTCAACCTTTCCTGTTTTGCTTGTCCACTGAAATTTGAGGTCACACCGAAATTCGTCAATTTCCACAAAGTCATCTTGGGTAAAACGGAATCTGAGAAGTTCATACTGAGGAATTACACAGCTGTCATGATTTATTTCGAGTTCGAAATAGATGTCACATCGGAGTTCAAAATATCAACATTCAATGGATATCTGGATCCTTGTTCTTCACTGGAGGTGACGGTCACATTCGTTCCTGAAAACATAGGAGAGAAGAAGGAGTCTCTAATTTTGAGGATATTCGACAAGGAAAAACAGTTCCCAGAACCAATTCAAACGGAAGTGCTGACACTCTCTGCAGAAGTGGCTACTTTCCCTCTGGAATATGAGACAAGTATCAATTTAGGTCTAGTGAAAGGCAAAGTTCCACATTTCTTCCCATTCACGATCAATAACTTGGGCAAATATGATGTGAAGATATTATTAACAAAACCACAGCAACAAGGCGGTCACCCTTCGATCGGAGACTTTTTCAAGATGAAACACATGGAGTACGTGGTGGAAGGAGCTTCGAAGTATTCTAACAATTGCAGATTCACCTGTAACAAAGAATTGAGTTTTGTTGATATTCCCGTTGTTCACGTTACTATTCTGGACAACTATAGAAATTCAGCTATAGATCATTTTACCTTCAGAGCGTCAGCAAAGGTGGCACTTTCCAAGTTCGAGCTCTGCCCACATGGAGAATACTTTTTCGGCTATCAAAACATCAACACCACTCGTTCCAGCTTGTTAACCTTGAA
>TRINITY_DN182_c0_g1
AAATAATAATTATTTAGGGATATTTGATTTATTATATTTGAGATTTGAGTTTTTTAAATGATGATTATAAAAATTGGTAATTTGTTGAAATGAATAATGATTTAATTTGGTAATTTTATTGAAAATTGTTTTTTTTATTTAAAAAAAAATTATAGATATAAATTTGATTTATTTGTTGGATTGAAATTAAAAATGTTTTATTGAGTTTGAATATTTGGAAAGAATTTTTATGTTGATGGATTA
>TRINITY_DN27_c0_g1
GGACATAAAGGTCTACAAAAACCAATACTAACATTTCAAATAAACCGGTAACCATTTTTCATACACTGAGGTGCATAATCCTTTGAACACTTCATCTTCTCCACCAGGACCGTACCGGCCCCAAAGTCCCAAAACCGGCCAGGTACGTCCCTGCCCATATCTCACGCTCCCCTTCCTCTTTTTCAGCCGTTCAGTTTGCAAATAGAAGAGGACCAACCGATAACGTCTGCCGGGAGACAAGGCAGGAGAAACAACAAGGGAACC
>TRINITY_DN45_c0_g1
CTTGCAATAATTCTTCGGTACTCAGCATGTATGTAGAATAAATTCAAAATATCTTCATTCATATAATTTCCAAATACAATTTTTATTTTTTCATCCAATTCTACACAGAATAGAGAGGTATTATTGAAAAATTTATGAGCTGAGCGAAGTAGTGTGTGAATTCTGACTTCTACTTTGTTATCTGTACAGAAAACACAGAAA
>TRINITY_DN144_c0_g1
AAGAATTTTTGCTGGACCAATTCCAAAAGTTTTCATTAATGGAAATTAGAAAGTAAAAACTGAGGTGGCGTCAGGAATTCTTGCCTTCTTACTCAAATTGGACCTATCTATTGATTTTTTTTACGAAATTCCACATATATGTATCTGGTGCACTAAATTAGTTGTCTAGTGGGGATCTCAGAATAGAAAAAATGAATGGCACATTTGAGGGATCGATTTTAGAGAGAATTAAATTGGTGCAGTGGCGAGGCTAGGGGGGAGCCAGG
>TRINITY_DN87_c0_g1
CGGACTGCTGCCAAATTTTGACACGTATCGTTTGACGGTTGGTACTAACTGAAAATCATATGGATTTAATACTAGTATTGCCATCTGCGCATCAGACCGGGGACTTTTCAGTTGGCCTAATAGGGTGATTGTTTAATTCGATTCAACATAATATCTTTATAGATGATTAGTTTTATCAATATCCAATCGAGAAGTTGGTAGCTGGAATTTCAGAATACACTTCTGATTTTTTTTTTCTTTACAGGTTGTAGGACACATCACAAAACAGTGTCTACTCGACATTGAAATCTCTCCATCTGGTTTATCATTTTGATTAGGAATGAAGATGCTACTATTGACGATACTTCCTAGCTCATTTCGAATCGTGATTTGCTATTATTCACTCGATTACTCAACAACCATTGGGCACAGTACAACCTGGAATTGGATGTAGTTTAGAGCAACCGGTTTTTCTACGTTTTTCGAAATCAATTGTTGAGCTACAGCCGCTTTTTGGTGCATTTCGCTTTGTCCATAGATTTCGAATTGAATAGATAGATCATAGATTGAAGTTTTGTAGAACCAGCATATAGTAAGTTTAATGTCAGAAAATAATGAAATTGATGGCAAATATCGATTTTGTAAATGAAATCGAGCAAAATATACACGAACGTTAAAACGATTGTTCACTTTTTTTCAAGATCGTCTGTAGGAATCATGCCTGATGGTAAAAAATTGGCTATGAATGGATCAATGAAAACATTCCAAAAAGAACGAAAACCCTTCATCCAACCCACAATTTTTTTTCCAGGTGGTAAACCAACAGTAGTGGGAACTGGATCGCCAACCGGTTTAGGTATACTTTGTGCGAATATTTTCTACAGCCGCTTTTTGGTGCTACCGGGGAAGCTTTCGAATATTATGCCATCTAAAAGGTTCTTCGATGCCGGTGTATTTTAATTATAGATGAAAAGTCGAGTCATGAGTATTGATAATCGCTCTGTTTGCAATATTGTGACATTAAAAATTTCACTGCTGATAATTTTTGGTGCCGTAAATTGAAATACCTAAGTTAAATTTTTGTCCCTCGGGATTTGTCTATAAAATATTGTTTTGTGATAATGTGATCCTTTCTGACATACAAAGCTTCTAAAAACAGAAGATTGTATATTATTTAATTGTTTTCTAAGATTGAATGATGTTGTATATTATTTGATTGTTTTCTAAGATTGAATGATAATTGAGAGGGGGATTGTTTGTCAAAGTTAATATTTTACGTTTATCGACTACAACACGACTTTGAGCTAGTAGTTAGAGCTACAGCCGCTTTTTGGTGCTACCAACTATACCACTAGGTAGAGTGATATCAGTATAAAAACCATCTCTAATTAATTATGTATTTATACACATCATTTCAGTTTGATGAGAATAGTGGGGAATAGCCCATCTATTATCAGGATACATCCATTTTTGAATTATACGTGTTGGCAACTGGATCGCCAACCGGTTTAGCTACAGCCGCTTTTTGGTGTTACCAACTATACCACTAGGTAGATAAATATGGCTAGAAACAAAGATGGTGGTAAACCAACAGTAGTGGGAGTGGTGAGACCATTTCTGGCATTATTTTTTGCGGGGAGTTTGATGAGAATAGTGGGGAATAGCCCATCTATTATCAGGATACATCCATTTTTGAATTATACGTGTTGGCAACTGGATCGCCAACCGGTTTAGGTATACTTTGTGCGGTTATTTTATAAGGCCCCCTATTTTTAAAATTGCCATCTAATCTATCATTATTCTTTCAACAGCTACAGCCGCTTTTTGGTGTTGGAGCTACAGCCGCTTTTTGGTGTAAACAGTGTCTACTCGACATTGAAATCTCTCCATCTGGTTTATCATTTTGATTAGGAATGAAGATGCTACTATTGACGATACTTCCTAGCTCATTTCGAATCGTGATTTGCTATTATTCACTCGATTACTCAACAACCATTGGGCACAGTACAACCTGGAATTGGATGTAGTTTAGAGCAACCGGTTTTTCTACGTTTTTCGAAATCAATTGTTGAGCTACAGCCGCTTTTTGGTGTTACCAACTATACCACTAGGTAGATAAATATGGCTAGAAACAAAGATGGTGAGTACTTATATAGAATAACTAAGTACGTAAAATAATAAAAAAATTTGAAACATTTTTCTTCAAATTCTTTCATACTACCAATCGTTCTCTGAATGGTTCAGATCGTCAATTCCAAGTAAACCAACAGTAGTGGGAGTGGATGCGCCAGTTGTATCAGTTTTGAGACCATTTCTGGCATTATTTTTTGCGGAACTTATTGGAACTATGATTTTAATGTTTGTAGGATGCGCCAGTTGTATCAGTTTCAATGAAGATCCTGCGGTACCACATCATATAAAATCACTAGGATTTGGATTTGCAGTGCATGTGGCTATACAGGTTGTAGGACACATCACAGCGTGTCACATCAATCCGGCAGTCAGTATTACAAGTTTACTTTTAAGAAAAATCAATATAATTCAGTTTGTGGTTTATCTCTTGGCCCAATTCCTGGGAGCAGTTTTAGGATTTGGACTGTTGAAGGTTCTCTTTCCAGAAGATTACGTCCAGAATGGTTTCTGCATGACGAAAGTGGGAGGGGGTGCAACTTTAACTCAGGGATTTTTTATAGAGCTTGTCATCACCTGCATCTTATGTTTCGTTCTTTGTTCAGTGTGGGATGACAGGAATGCCCAATGGGGAGACTCAACGCCACTCAGATTTGCCATAATTGTAGGAGTTTTATCTATTATAGGCGGTCCTCTTACTGGAGCAAGTATGAACACTGCCAGATCTTTCGCGCCAGCAGTATTTGGAAATAGATCAGATTGGGAAGATCAATGGGTTTACTGGACTGCTCCAAATATATCGCCTTGGACTGCTCCAAATATATCGCCATTTATATCAGTAGGTTTCTACAAATTATTTTTTTCTGAAACAAAGGCTAAGAATCGAAGTGAAGAATACTCTAATGCGATCAATAGTTGAACCAGCTACCTCTCAGAATGTTTTTGTATGAAAATACAATTTTTTTCCTATATTATGTTGTTATAAACAAAATGTACCTGTGAATATATATTTATCGTTACCAACGTCTCAAGTCTTTCAATTAAAGAAATTTTATTCTTAAGAAGTAGGTACAAGACCTAAGATCATATCAGTGTGAGTAGGTGATTTAGTGATATTTTTTTAATATTTATATTGAATATATTTCGAAAATTGTAATGAACTATTAAAAAAAT
>TRINITY_DN1_c0_g1
GGAAGGTATGCCATTAACATTGGAAAACTGTATCTGTCAAATGACCGACAAGGCTATGATCGCAGCAGTGTATCCTTCTCATGTAATTTTTATGACCACATTGGCACATTTGTGGCTGTATATCCTCGATAACTTCACGTATTCCATCTTTGAGGTTTTGAATTGATTCGAAGCATTGGCATATAATCGACCTTATCGTTCACGTTTCCTCAAAGAAAAAAGTCTAAAGGTGTTAAATCACAAGATCCCGGTGGCCAATTGTGATCACCTCTTCGAGGAATAATACTGCCAGGAAACTTTTCTTGCAAAATTGCGACGATTTTGTTGATCATGTGGCACATAGTGCCGTCTTATTGAATATTATGCCATCTTGCCTGCCTTCTTCCTCCTGATTTGAG
>TRINITY_DN16_c0_g1
GTATACTTCCTCACTCAAGGAGCCATTCAAAAAGGCATTCTTAACATCAAGTTGTTCTAATTTTAAATTATATTTTATAGTTACTGACAACAAAATTCTGAAAGTGGATAGTTTCGCCACTGGAGCATGTAACAAAGATAAATCATCAATATTTTGCTCAAAACCTCTTGCTACTAATCGTGCTTTGTAAATAGTTTCCCCATTATTATTACTTTTGGTTCTAAAAACCCATCTATTACTTATAATTTTCTTGTTAGCTGGTTTATTTACTAGTTCCCATGTATCATTTTCTTGTAAAGCTTCTAATTCATCTTTTATCGCTTTTTCCCAAAAATTCCATTCAGAGCTGGCTGTCGCTTCTGAATATGAATTCGGCGAATGACTTAATTCAGTTAATAATGCTAAGCAACTAACGTTCATATCAAAATCGTCATA
>TRINITY_DN158_c0_g1
AAAGATATGAAGATTCTAGAAAACTTAGTTGAATTAATAATTTGAAAAAAATTTTAAAATAATTAGTATCAATAATTATACTAAATGTCTTGTTACTACATTAGATTTCAAATTTGGAAGTCAGTATTACTTCAAGGCTTTGGGAAATTGGATATATTTACTTGTATTGTGACAAGTAATAGTTGACTAGAGTACATGTTTGACCAGCAAATAATTCAAAGGGTTTTGTCAATCTAAAAATGTAATTCTGATAAATGATAAAATAGTATTCTGAAAACTATAATTACATTCATTCAAGTTAGTTATCGCAGTGAGAAAAGACACCAATTGAAATCTTGATAGAAGAAGTAATAAAGATGACGATTAATTAAAATGGGGATCATGTTTTATTAAAAAAAAGACATCACACCAAATTGAATCTGAAGTTCAGATGAGTTTTGTTATTATAAGTTATTAGAGTTGTTATTTCAGAAGGATTAGATGATGGAGATAGTTATTTGTTA
>TRINITY_DN96_c0_g2
GTTTGTTTTAAATATTTTTTAATAACGACAAATGATTTGAATGTTGTACATTTATATCTTTGGGGTTCCATGAATTTCAACAGAAAGGAGTTTGGTCTTAAAACTGATACAGACGTGCATAAACGATTTTTCTCTAATTAAGTGATATCTACTTATTAGATATTTACTGTGAATTACTGACTTGGACAAAGATGAGATATCTCTGATCATAATATTAATTGGCAATATTTATATTATATTTATTATATATTGAATAGACCATTCAGATTAAACACGAATAGAGTTCCAAATTATTTTTACTTTTCTTACAATTATCGAATATTAGTATTATCACAATTTTTTGTAATTAGTGATGGATGATTTATTAACATATTATATTGATTGCATAGTATATGTATAGTCTAGAAAGAAGTTTCTCAAACAATAATACTGTCAAGTTTTTGAAGTGCACATTCAAAAAGAAAATGTCCAAATAGTAAACTTTGTAGTGAACTGAAACTTCGATGATACAGTTTAAAAGAATATCATAGATATTGATAACAGTGAGGTGAAACATCAGTCTTTTTGCAAAAAATATATACTTCTGACATTATTCATTAATAGTATCTGTAGAGAATCCAAATTCTTTCAATATCACTAATCCTTTCATAAACTATCGATAATGACAAATTATATACACAGTTATAAAATTTCTCTAGCAGAGTATGGGATATCAGTATATCCATACAGATTTAATGATTGGTAAATATTCAGTTAACAGACAACATAAGATACCACATATACTTTGGTCTCTTGAACAACATGAGCCATGATAAAACTAATTTTCTATCAGCTCTCAAATTTATAAAAATAAGAGCATTAATTTTCTGCAAATTATGAGGATCGCACTTATTTTTAATGATGATAGCAAATCAAAAGAAGGCCATCTAAGGCTATATATGAATTGGATTTGATTATGTATATCGTTGTAATTTTATATAGTAGAACCCCGATTGTCTTTGTGTGCTTTATGTCAGTTGATTCTCCGTGAGGCATTGTATCAACCTGTTCGCGGATTATCCGTGGTAGGCAGTAAGATCATGGGTTGGCGCACAAAAACGCTGAACAAACTGTTCAGACGCTCGTCTCGGGGAATCCCCATCAACATTTGAGTACATCCTATCTTCCAAACCGCAAACAAATGGTTTATTGCGGTGAACAAGTGAGTGGAGTGTCTCTAATGAAGCACGGAGCTCCTCAAGGGTCCATACTTGGTCCACTCTTATTCAATATACACATTTATCAATGATCTATCATCAAGTCCAGAGTGCCACACACAACTTAGACCTGAATGAAGATAAATAAAAA
>TRINITY_DN94_c1_g1
AAAGAACTGACAGAAAGTGTACCACCTCGAGTAACAAATAGAACTAGCAAACATAAAAGCGATCTATAATGACTTTTCATTAATTAATGATAATTAAAAAAAAATTTAGAAATGAAAATGAATCCGTCGTAAAAGGTAATTTGAACTAAACATTATTATTTAAATGAAATGGAAACAAAAAATTAATATTCAATTATGTAATCTTAATTGCAATTAATATATTAGGAATTCAAGTATTTCCATTTATAATAACTAAAATTTCAAAAACCATCTGACATTTTCATGTCCAAAGAAATTAACGATAAGTATAATAGAGACGGCGCTGTATCCAGTGGCGGGCCGGTATAGGGTAGAGTAAAGCTCACTACAGTCGATCTATAGTATAAGATGGCCGTGAAAACAAGATCTATTGACATTTTCTTATTCTCATCATTCATTTAATTCAATTCAAGATATTCTGATGATATGGTAATATTATATATACAATATAATTATTGAATTATCCCGGGATTTCATACTATTTATGTCGACGAAATTCCTTGGTTTGGAATGACGTTTAAAAGTCGTTATTTTTTGGTTCTTCACAACGAAAACCAAATGTTACGTTTTGTATAAGATCAATTCAGATTGCAGAAGTCACTAGAAGAGTAGTGTAAATTTTCCTAATGATTCAAATATAGGAAAACGAAAGAATCAAGTTTGATTTAGTGTCAAAATTTCAAGATTGCAGAAGTCACTAGAAGAAAGTTCTTTAATTGAATGTGTTTAATTACAATGCCTAAGAGAAATAATGAGAAATATTCAGATGAACCCAATAAGAAAATAGCTTTGCAAGACTGTGAAAGGAGTAGCATTGATATAAAGCCAGGAGAGATTCTCAAGGATATATGTGGAAATGAATGGATACTTGGAGAGACTATTGGATTTGGTGGGTTTGGTGTTATACATCATGTATCTGAAAGATATCCAAAGGGAAAAGAGAAATATGTTGTGAAGATAGAAACTCATGCAAGTGGAGGACTCTTCACTGAAATTAATTGTTACTTGAGAATTTGTAAAAAAGATATGATTAAAGAATGGACAAAACTAAAGGGTCTTCCAATATTAGGCATTCCGTTTTATGTAGCTTCTGGTTCCCATGTATGCAATGGTGTAAAGTATCGTTTTTTAGTATTACCTCGATATGAAAAAGACCTTGAAGGAATTCTGGAAGAGAAAAAGAAATTCAACTTGAAAACAGTTCTTCTCATTTCAAAGCAAATACTACAAGTTCTGGAATATATTCATGACAAGGGATATATCCATTCTGATATTAAAGCAGCGAATATCATGTTGAATCAAGTGAAAACTAATTCTAAAAGAAAGTGTCTTAAATCTAAAGTGAAAAAACAAACAGAAGTGTGTAGTGCACGGTATAAACGATATGACACTAGACCTGTGAAACACATTAACTATAATTTGGATCAATTATTTGATGATTATTCATTTGGATTTCAAGATGAAAGTTCCCTACTAGGGAAGGGAAAAGAAAAAACAAAAATTGCAAATGTTACAGGAGACCAGCTTTATTTGTTAGATTTTGGAAAAAATCTAAAAATGTATTTCTGTGCTTCAATGAATTTCCATATTTTAATTACAATTTTTTGATAAATATTGATTTTCCACAGCTTTATTTGTTAGATTTTGGTCTTGCATCTAAGTACAGACTGTCAACAGGAGAGCATAAAACTTGTGGAGATGAACGCAAAGCGCACGCTGGAACATTGCTTTTCTGCTCTAGAGACGCTCACAAAGGCATACAGTCAAGAAGATCGGACTTGGAATCTTTGCAGGAAGATCTAATGGATTAGGTCCTGTGGTGTCAGCAAATTCTGCCTATCCAGTAATAAATTGTCCACCAGTTAATTCCGGAAGATCGGACTTGGAATCTTTGGCCTATAACATGGTATATTGGTTGACAGGCTCTCTTCCATGGATCAATGATTTGGAAAATCAAGAAATGATGCAAAGGAAGAAAAGGCACTGTTTTGCGGATACAGCGGGATTCTTGTATTTCTGCATGCCTGATCCCCCGAGATTATTAAAAGAATTTTTTCTTTACATCAAAGGATTGGACGTCCAAGACACTCCAGATTATGACGGCTGTCAGCAGTTCATCACAAAGGCTTTGATGGAGCATGGGTACCAAGATCTGGAGTTCGATTTTGACAACTTGGAAGGTTGGAGATTAGTAAAAAAAAAAATTTCTGAAGACATGGAAGATGTTTTCAAAAGGCCTCCATTATTATCCAACATGCCGGCCCCACCCATACTACGTAAGAAAACAAAGAAAAAGAAAATCAATCGTGCATTAAAATGGTCAAGGATGCTTTCTGATCCCGAAATCCTTCTCAAAAAAGTCAGGGACCGGAAAGATAATAACGAATTTCCCAATGTTTTGGACTTTGACTTGGAGAAAATGAACCCTACTCCGGCAATGCGAGAGGTTTTCAGGAAATACGAGGAAAGGAAGGGACTGTCTCCCAATAGCTATCCAGAGACGGATTTGGGCGACCTTCCGGAAGGATACACACCTGCAATGGCGGCGGTAAGACTTAAAATGTTGGAATTACAAGAATTGGAGGAGGCTGTGAAACCTATCAAAAAGAGGCAGAAGAAAGCAAGGAAGATTTCAAAAAAGTACAAAAATAAGGAATGTGGAAAAACGAAGAATAAGGTTGCCCTTCCCACAAGGACATACTCTTTGAGGGGATGATATCCAAAATTAATTTTCTATATGAAGCATTTGATTAAACAATGAAAATGTATTTACTTCCGAAGAGTCCTATATTCTGTAATTTTCAACTAAATGTGGTAGATCATAAAAAAATTGTGATAAAGTTAAATACACGTTAAAATAAAACAATAATTTCCAGCTATAATATAATAGAAGGTATTGATTTTGACGATTCAAAAAAACATCATTATTTTGGATAATTGAAGATGTCAGTGAATTTTTATCAAATAGAATATCGCAATATCCCAATGTTCTAATTTTTTTTCACGAAGAAATAAATTTTGTGAAATTATTTATTACAGTTTATGTTATGTATCACGTTATAATTTTACAGATTTTATCTGATATACAATTTTCGTCCTCAGAAATTTCAACTGATACAGGTAATTGGCAATTTATTTTTTGTTAGATTAGTTACTATTATCGCAGATTAATGAGTATCATAAATGTTCATTATACGCAGCAATATCCTCCTGTATCGGTTTTAATTTCTGCACTAGAAGAAAATGTTCTTTTTCAATTAATTTATATTATCTGTTATTTCTTACTGTGAATAATTTATGTTCCTGGTAACTGCAACTTTTTTTTGATATTCTGTGTGCTTTGTAATTGTATAAAGAGATCTAATTTTAGGTATGTTTTTTATAGTTGACTGCAAGAATATTGAGTTCTTTACTAAAATGACAACTTACATGAAACAAACTAAGTCAGATATATAATTGATAATTATACCAATATTAACTTAATACTGTGATTGTAAAAATTATCTAAATTTTGATTCTTTGCAATAAAGCTGTTCCAGTGACGGAAATGAAAATGAATCCGTCCTTTTTTACTAATTTAATCAGAATTTAATATCAAACCAAAGCTTTTAGTTTTAGTACTTAATTATGACTTGAATATTAATGATGCAATTTGGTTATTATTTCATTATTGACTCATTAAATCTATTTTTGAATATAAGCATG
>TRINITY_DN65_c0_g1
GAACGTTCTAGTGTTGTTTAATGTGATGACTCTTTTCTTCAACTCTGCCTATGACTGCGCTGGGTGGATTGAGTAGCCCAGTGCTTTCATAGCCGGTCCCAAGCCCGGAAAAAAGAGGAGGGTTTCAAGTGAGGCCAGCGACCTACTTGGGTAAAAAAATGAAGTGCTCCTGGAACCAATGGCCTAGCCTCGGATATGACTGGATTTAATAGTAACGACCTGGCGAGAACAAGGAAACACAAACGGAAGCTGATTTTACTCAGAGTGGGATGTTGGAACGTGACATCATTTAATAATAAAGACCAAGAAATTATTCTCGAAATGAAAAGGCACAAGCTAGACATTTGTGCACTGTCGTAGACCAAGAAGAAGGACAAAGGAAGCAGCAAATATGGGGAATACATACTGATTTATAGCGGCAAGAATAAGAATGAAAGAGCAGCATCAGGAGTAGGCCTACAGTTACATGAAAAATTTGAAACCCATATCAGCGATGTTAAATACATTGACGACAGACTATTACATGTGACAGTCGGACTACAAATATCACATCCAACACACATTATAAGTGTTTATGCACCCGATACGAGTAAACCTCAAGCAGATATAGACTTATTCTACCACACATTACAAACAACTTTGGACGATATACCTGACGAGGATGAAATATTGATCCTTGGAGATTTCAATGCGAGAATTGGTGATGAAGCTATACCTGGTGTCAAGAATCGATTTAACGAGGAGACAATGAATGAGAGCGGTGATCAAATGGTACAATTGTGCATGCAGAATGAACTAAGGATCAATAACACCTTCTACCCACATAAACCACAACATAAGTACACCTTCGAAAATACACGAGGGCATAGGTCAATAATAGACTACGTGGTCTCAAATAAAAATATCCATCCGACAAGAAAACAGGACGTACGATCACTAGCTTCCGCCAATGCTGGAACGGACCACCATCTTGTATTGGCAAAAATACGAACAGATGTGCAACCACCTCATAAGAAATCCACCGAGACAAGAAGTATATTTAATATAGAATCCCTTTCCGACGACTCAACTAAACAGCTGTATCGGCAAAGGCTCCGAAGAAAAATAGTTGCGAACAACATCCAAGACTTCGACGACGTCGAAACGGCGTGGGCAAAATTAAGAACTAATATACTTGAAGCAGCAGAGGAGGCATTTGGAAAAAGAACTATAAAGAAAGGGGGAAAACCAAATACGAAACCCTGGTTTAAACAAGAAGTTAAGATGCTGGCCGAAGAGAAGAGAAAATCTTACTTACAATATAGATCTAATACGGTGACATATCATGAGTATAAATCTGTGAGGAATAGGGTCAACGAAAATATCCGGAAAATCAAAAGGGATCATTGGGAAAATTTTCGAATGATATGAAGCATGATCTTTACGGGGGACAAAGGAGAATATGGAGTCTACTCAGGAATAGAAAAAAGCCAATAAATGAGTACATACAAAACACAAAGAGAAAATACACCAAATAGTCACTAAACTGGAAAACAGAAAAGCTCAAGGCATTGATGAAATATCGAACGAGATGATCAAGTATGGAGGGAACACGTTACACGAAGAATTGCAGACTTTTTTTCAATAAAATACTGGACACCAATAGTGTACCATCAGAATGGAAAGAGAGCATTTTGATACCGGTCTTCAAAAGGGGAGAAAAAAGTGATCAGCATCATAATGGATGAGATAATAAACGCAGTGAAGAAGGCTGGAAGGGGCGCAAGCCAATAAATGAGTACATACAGAACACAAAAATTACTCTGAAAGAATGGGAGAGTTATTTCAAAAACCTTTACGATTCAACAACACCGAGCACATCACCGCAGAACTTACACCAGGATGATGAGGGACAAACCCAGAGGTGGACCATTTCGTTGGAGAAAATACACCAAATGGTCGCTAAACTGAAAAACAGAAAAGCTCAAGG
>TRINITY_DN95_c0_g1
GTTCTTGCAATATTATTTTAACCTAGAAGCTGAAAATGGACGTTTGTCATTGAAGTTGTTCAACTAAGTACAATTCTCGTACGCCGTAGAAATTCATTTGAAGAAAAAAATATACTTCCAAATTTCGAGGTAAGTGCTTCAATCTAACAAGTTTTAATTAAATAAATAATGCATATATTATTTTATCAGAATGCCTAGACTAAAGAAATGAATGCCTAGACTAAAGAAATGTTGTGTACAAGGATGTACCGATGAGACAAGTACAAGAAATCATTTCCCTAAGAGTAATTTGGATTAATTCACAGAGTAATTTGGATTAATTCAATAACTGGCTCCAAATGATCCAACCAAGATATTGGCAACAATTCAGTAGGCATCGAATTTATGAAGGTTATTTTGTGTGCCATTCACATTTTGATAAAAAATATCATCTTCCAGGAAGCCATCGTGGTCTTACTTGCAATGCCATACCTACAATCAGTATTCCAGGTAATTTTATCGAATTACTCAATTTTATTCATATTTAAACCCCTTAAATTTTTGTTCCATGTGTACTGTCCAATGGAGCTGTAGTATATTCTGGTTTAAACGATACTAAGAATTAGGCGTTACATAGTATATATTTCAGTAATAGTTATAGGATGTAGTATGTTTCTAGTTTGTTGGTTTTTGAATTCTGATGAACATTTGATTTTTTGTAGGTACTGTATGCACTGATTGATTCTCTCAATGTATCAAAGATTCGAAATACACAGGGTAAGTTTTTGAAGGGACCAATAACCACAAAATCGGAACTAACCAATAACCACAAAATCGGAACATGAAATATTTTGGAAAAAATCAATAAAAATTTTTGAAAACATGTATTTCTATGATGAAAAAAAACAAAAAAATGTGGTGGTACCTACCATAAAAAAGTGGTGGTACCTACCATAAAAAATTTTATTTGGACTTTAAAAGCTTTCGTTTACCTTAAGAGGAGGTTGTTAACTGAAAAAAATTTCAAGTATATCTTGACTGGTGCTTTCAATCAAGATTGCCTTGAAAATTTTTTCAGTTATATCCGAGGGCATGGTGTAAGGAACACTAATCCAAATATTGGCCAGTTTATGTCCTCTTTCAAATGCCTTACTTTGAATAACTTCATGTCCTCCCATTCTGTAGGTTCCAACTGTGAAGAGGATTTAACATCACATTGTTTGGATAATCTAAAATCATTTGTTTTATCAAAATTTCCTTTACCTCAAAATGTTGTGCTTGAAGATTTAAATATAGTTATTCCGAAATTAATAGTCCTTGAACAAAAATCAAAATTTAGTAGATGTACTTTAGTTTATATGTGTGGATTCATTTGTAAAATTTTATTTAAAGATAAATTGATCAAACAATGTGATAAGTGTAAAAAAATTTTAACCTTTAACAGTGAAGAATTGGG
>TRINITY_DN23_c0_g1
TTCATCATATTTTAATAATCTTACTTTCCTACAATATTGATTATTATATTTTACCAGGTACAAATACTAGTAAGATTAGGAATATATAATTGACCTAAATTAAAATGGGCTTTGACAAGACTAGACTCGTGTGAACAATTATAATTGAACTAATTATATCTTTCGAGAATCAATACCGCAGACTCGATAGGATAAAATAGGAAATTCGATTGAAGTTATTTGCAAATAAGAATTTAGTTGACTGACTAGAATTCCTTTCTTCTTAGAGCAAAAATAGAAATTTGAGAGCTCTTTTAAAAAATTAGGTTCATTCAGAATACAATATAACTTCTGACCTAAATGAAATTGAAACATTATCATTAACTTTGGCAACAAGAAAATCTTTGGTACTTCTGACTAGAAAAGAAAAGAACATCGTGAATTTATAGCAGCCTACGAATCAATGGAAACCCGCCTACGAGTTCTGAACACTGTAATGTCATCATTGAATTTTAGCATGCATTTATGTTTATTATCCAAGTGCCTTTTCAAATTAGATTGCTGATGAAATTTTCGCACGCAAAAAGAGCACTGGAACCGTGCTTGTTTCCCGCATTCATAAACCATGTGCCTACGCATGTTTCCTCGATGTTTGTACAGCTTACCACAGTTGACACAAGGAAAGCCACTTGTGAAGTCGACTACTTCATTTTGTCTGAGAAACCATTTGTCTCCTTGTGAATCTCGATGTGCACCAACGGCCTCCTGTGCCGCTAAAAACACTTCATCTTGACTTTGATTACCGATTTGCCAAGATCCAAAACCTTGACTTGATCCTTCACCCATATTGCCATGACTTGGCCCAGCGCCATCTCCCATGTGTTCCATATTACTCATATCATCATCATCTAACGTCAAATCCTCAATACTGTCCTCATTCATTTCCTCAATATATTCAGACTTTGGTTCTAGCATCAGTTCTGTATGGG
>TRINITY_DN55_c0_g1
CCCCGATCAAAAGAAACAACGCATTTTCGATTCCGAAAGGTGTTTAGAGCTGTTTAAGCGTGATGAACAGGATTTTTTACGTCGATATGTGACAGTTAATGAAACATGGATTCATCACTACACTCCTGATTCAAAGACATCAGCTGGCAAGGTTATGGCATCTGTATTTTGGGATGTGCAAGGTATATTGTTCATTGACTATTTTGACAAAGGTAAAAAGATCAGCAGTGAATATTACATAAAGTTATTGGATCGATTGTGTGCAGAAATTATAAAAAAGCGTCCTCAAATGCAAGAGAAAAAAATTCTTTTTCACCAAGACGATGCCCCTTGTCACATATCGATGGAAACCATGGCCAAATTAAATGAATTGCGCTTCCAACTGCTTGACCACCCAGCTTTTTCTCCAGATCTGTCCCCCAGTGATTACTGGCTTTTTGAAGACCTGGGAAAAATGCTCCAGGGAAAGAAATTTGGCTCAAATGAAGAAGTCATTGCTGAGGTTGAAGCCTATTTCGAAAGGAAAGACAAATCATTCTATAGAAAAGGTATTGAAAAATTAGAGGAGCGTTGGAGTACATGTATCACTCTTGAAGGTGATTATGTTGAAGAATGAAGTCGAATTATTAAAGAAAAATATATATATATTTTTTTACTGATTAGGTTTGAGACCAATTGAGAGAAGTGTTATATGAGATGTGATTATAATTGTTGTTAGAAGTTTATCGAGGAGTTCTGATGATACAATCCTCTTGACATTCAACATGAACATTCAAGTGGTTATTTCCCATTATAGGTAACCGGTGTGAAGTTGTCCACATCCACAGGTGCACTCCTAGCCAAGAGTGGTGTCCAAGCGAAGGGTGATATATTTGTGATTTTCAATGTGAAAATGCATGGTAGTTTATTATTTGACTCAAGCAATACAGACTCTTCATATTTTTTT
>TRINITY_DN89_c0_g1
CGTAAGTCCTCCTATTGGCATCCACGATATGTTTGAGTTTGTTGATGGCGTCTTGGGGGGCTTCCAACGGTTTTCCCTCATTTCCGCTATGCACAGCCAAATGGGAAACCATCATGAACAGTGGCGTGCCGAGTTCGTGGTTCTGGATGGTATTCACCGCGTATTCCGTGAAGACGTCAGTGGCGTATCCGCCTACGCTCTCCCAGGACGGTGCTTTGTCTCGTCGCAGGTCGAAACCAGTGTATTCTTTGTCTTTCATCTTCCAAGTAGAGAGATAATCGTAGTAGCTGGTGAATTCGTTAAAATAGCCGAAGTGGTGATCAAAACCTCTTTGAGTGGGGGTTGCGTTCCAACTGGAATAGCCCAAATCCCATTTTCCTATTAGGTAGGTGGAATAGCCCATCTCCTTGAAATATTGCGGTAAAATTTTTCCTTCTGGCAGTGTCCTCTTCTCGGATACTTCTATAGAAGGCCCCTGCATCCCAAGTCTAGTAGGATACTTCCCAGTGAACAATGCTGCCCTAGAAGGTGTTCCCATGGATTGAACATAATGGCTATTTAAAATGATACCGTTGTACGCCAGTGCGTCGATATTCGGAGTAGGTATCTGATTACTTCCGTGGAAACCTACATCATTCCAACCCTAAACAATAATTAAGAGAATTAAACAAGTTTTTATGCCAGGCGGATCTTTCGCCAAAGAGGTTGATCTGATTTTTTACGAGGGAGTTCCATTAAATGGCCCATGAACTTGATCACTCGATAACATTTGATTAAGAATGCTCTCTGAAGATCTTTCGTTAGTTGAGAATCCGCTAGTTTACAATGTTTTCAATCGGTTATTGGAGTCTATCCCACCAAAACTGTTAAGATTTCTGTCAGAAGCTAACTTTAGGTATTCTATTTTATTTTGCACTTTTCTGAACTTTTAGGCATTTCCTTTGACTGTTTTTGTTTCTTTAAAACATCAGTTTTTAATTCAAGCATTCATGCCGTTGAGGAATCAATAAGTGTTTGTGAAATAACTTCAAAAATGACCCCGCTAGTTTACAATGTTTTCAATCGGTTATTGGAGTCTATCCCACCAAAACTGTTAAGATTTCTGTCAGAAGCTAACTTTAGGTATTCTATTTTATTTTGCACTTAAGATCGTCAGCTACAATAAAAACAATATGAGGTCTACCAGCGCTGGAAACAAGTCCGAATCCACTCAAACAAACAAACAGAACGCCAAAAAATCGGTTTATCCCACTCATCTCTCACAAAAAAAATAACACATAACACTAAATCCGGACGACAGTAGAACGTCTCATTTATAGCCACTTATCCTG
>TRINITY_DN25_c0_g1
GTCGTCATAATCGTTCATCTGAGCGTACAATTTGTAAGACAGCGAAAAAATTCGAAGAGACTGGATGTGTTACTGATGTCTTAAGGCCTATACATCATCAAAAGGCAAGCTCGACCGAAAATATTGCTGATGTGAGTAAAATTGTTGAAGAAGATCCAATTTTAGACATTTCTCAGCGCGCATAAAATTTGGGCCTCGCTTAGAGCACGCTCTGGTGTATTTTGCATCTGTATTTAAAACTCCATCCCTATAAGGTTCACTTTCCTTTTTCTAAAAACCAACTTTTGTGTAGAATTAACAAAATCATTTCAGTTGCCATGAGTTTCCAAACAGGCAGTTTATGAAATTTGAATCAGATTTGATAATACACAATTTATGTAGACGCTGTATTATCTTCATTGACTTCTTACAAGAACTTTATATTTTGGATTGAATCTTCGTGTTGATGTTTTGTACTGAATTCCAAAATTTCATCATTAAAATTTACCTTTCAATATTAGCCAATT
>TRINITY_DN38_c0_g1
TGGGAAGGTACTTTGATGCTATACAAAGCTATTTTTTCACTCCTTACCATCCTGTCAAATAAGCTAGATATTGTGATAACTTGGGACACCCGGTATAGGATACCAGTTTCGTGAGTGTAAACATTTACTCACGTAGTCACGTAAATCTAAAAATTGAAACTTCCGACTCGAAAAAAAATTGCGTTGAGGAAGTATAACCCCATAAGGCTCGATGTAACAGAAATGGCTTTAGACCAAAGCCCCTGATAAATCAGCTCGCTGCATGGCCCGAATTTCTTACAGCATCCGGCTGCTCGAGATAACCCCCAAATGAAATAACCATTACCTATCTCCTCCTTCGATGCCTACAAATGAAATAACCATCGCCTATCTCCTCCTTCGATGCCTAGATAAACTGGATATAAATCACCTCGAATTCAGTCTAACGCCCTTGCCGATACAAATTCGTCCTGCATGGGACAGTGGGATGTAGAGTAGAAGGGCGATTGAAAAGGAAAGATCGGGGGACAGTGGGATGTAGAGTAGCAGGGCGATTGAAAAGGAAAGATCCTCTCGAGATAAATTAGAGGAGGTCAGAGCTGAATCAGTTCAGGATGGAAAAATCCGGCATAAAACAAGACGTACTGTCTCATTTTATCATCGTTTCTGGACATAAAACAAGACGTACTGCTTTATTTTATCATCGTTTCTGGTGTTTTGTTATTGTAAAGGGTG
>TRINITY_DN96_c0_g1
CAATAATTGATTTTCCTATGACAGCCAACCTAAGCTTATGAGTTTCTGATGCATTAGGTCATTGTCAAATTGAATCGAAGTGTATTTATTGAAAATATTTGATAGCTGAATATTGCTAAATATTACATTTTAACTGTTTTCAGGATTCACCAACTATTTAAAACTATGGATTCAACTTCGTAACTGCATTATAAATAATAAAGATTTTTCCAGTGGTTGGAAGGTATTCAGTTGCAGAGAAAATAAAAGCAACGAAGATAGACTCCGGGTGGGGTTGGGCGTCTCCGCCCTTACGTCTTCAATTAGCCTCGCATTTGCGAGGCACTTGTAGAATGGGAGAAATGGCTTTGGGGGATAGACCCCCATCTCCTGCCAGATTGTCACATACTTCTGATAAACATCCCAAAAATACTCTCACAGAGTTGAATTTACTCAGAAGGCATCGGGAATTATGTGATGTAGTTTTGAATGTGGGCACTAGAAAAATATTTGCTCATAGAGTCATTCTTAGTGCATGTAGTCCCTATTTTAGAGCTATGTTCACTGGCGAATTGGCTGAATCTCGACAAACAGAAGTTACAATCAGAGATATTGATGAATTGGCAATGGATTTACTTATAGATTTTTGTTATACATCTCATATTGTAGTTGAGGAATCTAATGTCCAAATGCTTCTTCCTGCAGCCTGTTTATTACAACTTACTGAAATACAGGATATATGTTGTGAATTTTTGAAACGCCAATTAGATCCTTCAAATTGTTTAGGAATTAGGGCTTTTGCAGATACTCATTCTTGTAGAGAATTACTAAGAATTGCTGATAAATTTACTCAGCACAATTTTCAAGAAGTAATGGATAGTGAGGAATTCTTACTACTTCCTGTTAGCCAACTGGTGGATATTATATCTAGTGATGAATTGAATGTGAGAACTGAGGAGCAAGTTTTCAATGCTGTTATGTTATGGGTGAAGTACAATGTGTCAGAACGCAGGCAGCATTTACCTCAAGTCTTACAACATGTTAGATTGCCACTTCTTAGTCCCAAATTTCTTGTTGGAACAGTTGGATCTGATTTATTAGTGAGATCAGATGAGTCGTGTAGAGATCTTGTAGATGAAGCAAAGAATTACCTCCTTTTGCCTCAAGAAAGACCTTTGATGCAAGGACCAAGAACAAGGCCTAGAAAACCAACAAGAAGAGGTGAAGTTCTTTTTGCGGTTGGAGGATGGTGTAGTGGAGATGCTATAGCATCTGTAGAAAAATTCGATCCGCAGACAATGGAGTGGAAGATGGTTGCACCTATGAGCAAAAGAAGATGTGGGGTTGGGGTAGCAGTGTTGAATGATTTGTTATATGCTGTAGGAGGACATGATGGCCAAAGTTATCTGAACAGTATTGAAAGATATGATCCTCAAACTGACCAGTGGTCTTGTGATGTGGCACCTACAACTTCTTGTAGAACAAGTGTAGGTGTTGCAGTTCTTGACAATTTGCTGTATGCTGTTGGTGGACAGGATGGAGTACAATGCTTGAACCATGTTGAAAGGTATGACCCCAAAGAAAACAAATGGACAAAAGTGGCCCCAATGACAACTCGTCGTTTAGGAGTCGCTGTTGCTGTGTTGGGTAATTATTTGTATGCCATAGGGGGTTCAGATGGTCAATCCCCTTTGAATACAGTGGAGAGATACGATCCTCGTCACAATAAATGGACGTTAGTTAGCCCAATGTCGACAAGAAGAAAACACCTAGGCTGTGCCGTATTCAACAATTTGATATATGCAGTAGGAGGAAGAGATGATTGTATGGAGTTGTCTAGTGCCGAACGATACAATCCACATACAAATACATGGAGTCCTATTGTAGCTATGACATCTAGAAGAAGTGGGGTTGGTTTAGCAGTTGTAAATGGGCAACTGTATGCTGTTGGAGGTTTTGATGGAACAGCTTACCTTAAAACAATAGAGTTTTATGACACAGAGCAAAATCAGTGGAGACTATGCGGATCGATGAACTATAGGCGATTAGGAGGTGGAGTTGGTGTTATGAGAGCACCACAAACTGAAAACCGAGTCTGGTAGTATTTCCTAATCAATGCGGAAAAAATGAAAAGGTCATTTTAGCATAACCATGACAAGGCGTGGCAATGAGAGAAATAACATCTCATAGAGCTGAGAACTCTATGGCAGAATTATTGTTGAAAATTGAATTATTTATTTTATTGTTTTCTTGGGAAATATCGAGTTAGCGGACACTAACAAATACCACAGGTTTCTGCAATGCATAATTTTATTTTGATCTCTTAGTTAAGACCTAAAGTATTAAAAATGTTTCTTCATTGACTCTTTCATTTCCCATAAAGGGCAGCTATAATTAAATAGGACAAACCTATGTTGACAATCGTTCTATATATAATTTAGTTTTTGTTTTGTTTTTGCCAATGTATGATAGTTTATTTATTCAAATGTATTTTGTTGATACAACAAGGCATTAAAATACAGTAGAACCTTGATTATCTGGGCTGGGATCTAGCCTTTGCTGGAAAATCAAAAAATTCAGTTTTAATTTTTTGTAACAATTTTTTGATTCAATCACCGTTCTAAGTCGAATGAAGAGTTATACTACAAACCCACATCTGAATGAAATAAAAGTTTATTTATTTATTTATGAATGATGAATGAATATACATACTAGATTTCGAAAATCTCTAGAAAAAAATCACTAATTTCTTTTTGTTTTTGAGATTTGCCACCTTGTAAGTTCCCTCATTTTTCTGTGCTGAAGCAGATGAATGTCAGGAAAATATCTAAAAAAATCACTAATTTTTGTTTGTTTTTGGGATTTGCCTCCTTGTAAGTTCCCTCATTTTTTTTGTGCTGAAGCAGATGAATGTCATCAGTTTCAATATATCTTGAAAATATTGGATAAGTACATTTACCGCATCCTCTGCTTCTCGATGACTTGTTTTCATAATGCAGTTATTCTCATTGTCATCTGCATCTTCTGCTTCCCGATGACTTGTTTTCATTATGCAGTTATTCTCATTGTCATCACCACTTTTGTTTTTGAGGACTGGTTATTTAGATAATCATCATCCTCAATTTGATGAAAGCCATCTTCTTTGTTATCATATCATATTTATTCTTGCATTACATTATTGTCTATTCCTGTTATCATATATTTATTCCTGCATTACATTATTGTCTATTCCTTCTAAACCTCTGATTTGACTCTATATTTTTGATCGATACCTCACTTTCATCTAAGTTATTATTACCTTCAGTATCGCCTTCATCTTTTAAGGTCATTATTTTATAAAATGTGTTTTTGATATTCGTCTCTTTCACTTCTCCCGAGAGTTGGTCTCTCCTATAAAGCCTTTTCATTGCCTCTATAACACCTTGATCCATGGGTTTGGCAAGAGATATTACATTTGGAGGATAATATAATGCAAATATGTTACTATCTGCTGATCTCAGTTGCTCCGATGGCGCATTAGCCAGTAATAGTACAGTCTTGCATGGAAGACTATTTATTGCAGATAAGTTTCAACTTTTGTTACACATTTTTCGAAAAATAATTTTTTCATTAAACCAAGATGCCTTTTTTATAATAATAACCAAGATGCCTTTTTTATAATCCCAGGCAATATCTTTACATTTTTGAAAGCCCTGGCATTAATTGATTTTCCTATGACAGCGAACCTAAACTTATGAGTTTCTGATGCATTAGTGCAGCATAAAACTGTCACACAGTCTTTGCTTACTTTAAAACCTAAATCAAAATTTACTTAAAAAAATGTATACCTGACGCTGAAACCTAAATGAAAATTTACCTAAAAAAATGTATACCTGACGCTAACCTGTTACACTATTTTCTGAGCCCACAGCAAGTGTTCTTTTCTGCATTGCTTTCCAATAAGGTGTTGTTTCGTATTGCTCAGATATTAGATTGTATTCTGTTAATATTAGATTGTATTCTGTTATGTTTTCTAAATCGTAGCAAAATTCTACCATAGCATCAATATCAGCACTTAGTTTCTCTGATTGCATAGATATTCCATGACGTTTTTTGAATATTTATAGCCAACCAGAAGATATCAACATCAGCACTTAGTTTCTCTGCTTGAATAGATATTCCATGACGTTTTTTAAATATTTATAGCCAACCAGAAGATCCTGAAAAGTTTTAATTAACTACTAGTGAAACGTTTGGGCCAACTACTAGTGAAACGTTTGGGCTGGTCTGGCACACAGGTCCTGATACTTCCAATAAAAACCACCTAGTCATAGCATCGTCCAGTTCTCATGTCTGGCACACAGGTCCTGATCTTTTCAATAAAAACCACCTGGTCATAGCATCGTCCAGTTCTCAAAATGTAGACTCTTTCAAAGATTTTCTGTCAGAAATAGATCTTGCACCGTCAGCTTTATCTACAAAGATCTTTAAAACGGTTTTTTTTTCACAATGTCACAAACTGTTTGCTTTCCAATATTGTATGTTTCAACCAACATGGCAACGCTTTTGTTATTTTCAAATTGTTTTACTATTTCCGTTTTTTGTACAATATCTAGAACCTTGTGTTAGGTTTTATAGCACCAGTAGGCTGCATTGTGTCTGCTCACATTATTTCAACTAAAGAGTTGGTTGGCAGTTGGCAAGAATAAACACATATTATGTAGAATAGAACTTAATTAGACTGTATAATAGCTAAGTCACAAAAAAAAGTAATTAATACATTCACAAGAAAATCTCAAACAAAATCATCCCAATTCTCCATAGAACTCTTCCAAACTATACAGGGTGAGTCTTTGACTTGTACATATATTTCAACAGAAGATTGACAAGTAATGCCCCACAAAGATTGACAAGTAATGCCCCACACAGAAATTCTATCATCATAGTGTGAGATGAGAATATAATAGTTTTTATTTATCTTCATTCAGGTCT
>TRINITY_DN114_c1_g1
CGTTCTTCTTGGGTACATAAAGAGTAGTCATCTAAATCTGTGAGTTTCTTGTGAAGTGCCTGTCTCCTATTAGCTTCCTCTGAGGCGTTGAGAAGTTGTTCTTCAGTTTCCAAAGCGTTGTGTTCTTCCAAAGTGCAACTAAACAATACGAAGTAGACGCAGGACAGGTCCTTGGCAGCTTTCAGTAAACATCTCAGAGCGATTTGTAAGTTAGGGAGAAATATACTGTCTAGGCTCTCGAGGATCACTTTGTCCAATTGATCGATTTTATCGGAGAGTATCTG
>TRINITY_DN114_c8_g1
ATAAACCATGGTTTTGTGGTAGGAAAATAAAGTTGGTCTTAGTCGTTTTTCCAGGCAGAATATGTCCTTTATTAAATTCACAATGAAAAAATGATGGCTTTTGAGACTCAGCTCTGATCTTCTGCCAAACAAACGAAAACGGATTTTGGGTGTTATTGGTTATCAATATGGACCTGTTAGATTCTGATCCAATTCCAAGAGACAGAAAATTGAGGATCTTAGTGTCATCTCCCGATCTCAATCCGCAATAAGTTTTGAAACTGTTCTCACTCATGGTGAAATCTTGCATGAAATTCGAGCTGAAAAGGTAGGGAAAATCTAGACTTTCACCCTTCAAGTTGATCTCAAGATCTACTGCTTCCGGGTCCAAATTTTTCATGTTAGCTTTGAGGAGGTATTCATGAATCTTGTGATCAATGGGCATAAAAGTTATCGCAAACTCTTGGTGCTTTTTTGGTTGTATGATGCACACTTTCGGCTCAATCGAAAATTCGCTTGCAACTTGAACGTCACATACTTTTTGGGGAATTTCTGGTACCGAGAGTTGCATCTTTTCAAATAAACTTGGTTGCCTTGCAGAAGGTCCAGTATCCATCTCCTGACAACGACTGATAATCCAGTCTATTTCTAAATTGACTTTACTTTTATTTTTAACACTGAATGTTTCCGAAAGAACCGTATGAATATTAGTTGGTGGAAACAGAATCTCTTGCGTTTCACAAAAGTAATCGGCATAACCGCATTGGGCATTGACAGTTAACGATATAGAAGATCCTTCTTTCGCAGTGTCGTAGGGAGGCTCATTGTTCTCGTAGACGACATTGTCAAGAGATAAATCTCCGCAATCGTCAGTTTGTTCTTCTGTGGTTTGAAATTTAAATTTCGCCAAGTTAGCATTCTGACGGTCATCCCATGGTAGTGGAAAGATATGACCAGGATGCAGCTTAATTTTGGTAATGGTCAAAAAAAGCTCCTTCTCGGTGAAATCGATGTGGCGCTTGGTTCTGAAAGCGCCTATGATAGTTTTCTCCGATTCTCCATAAAGATGTCCTATCCTAGGCGAAAATATCAATTCCTGTATCGGATGAAACTCGAACCTGTAGATGTCGTTCGTAATGTTCTTCACCTTGAAACGAATCTTGTACAATTCAGTCTTGCTTACTGGCCCATAGTTCAGAGAATAAGCTATCTCCTTTTTATTCGGGGACACGTGAACAGGTAGGCCTTCTAGGCATACAGTTGCGCCAAAAGCAAATGCATTCAAACCAAGCTTCCACATATCGAAGCAATTATTCATTACTATTATTTGCAATTGGCAATTCAGAGATGTCGCTGACTTTGCCTCAAATTTGAGGTTAACGTATCCTTTTTCTCCAGACTTTAGCGTCATCACATCACTATGCTTCTTTTCGTGATCTACGACATCTTGCTCTTTCTGTTCGTGATGCAGAGATAGCGACATAAACCAATCAGGATCACCAATTATCTCCACCACTATCTTGCACGGCACATAACCTCTATTTCTCAGAACCACAGACTTCTCACACGAGCTCTTGATGGGCAAAGGCCCGAAACAAATCTCTGTATTCTCCCCATCGATATTGTAGTCAGGTTCTACTATTTCTATACTTGGCATACAAGCCTCGCCAATGAGACTCATACTATAGTTGTAGTCGGAAGAATAACCTTGGCATTTAATTTCTAGAGTTCCAGTCCAAATCCCAATCGCCTTTGGTGCAAAATCAATAACGTTGTACTCAGTTTTATAGGGAGCAATATCGATTATTTTCGATTGGATGGTGAATCCACAATCTTTTTCTAGGATTTCATACGAAACTGTTGCAGTTACGTGTCCTGTGTTTGGCACTCTGAACTTGGTCGATACTGAATCATTCAAGGCCACTTTTCCGAAATGAAGGGTTTTCTTACTGACCTCGAAAACGATATTCTCGCCTATACACGGAAGATCCTCGATATTTTCGACAATATACTGCATTGGGAACATGGTTTCGTAATCGCTGAAATCGATTTGAGGCTCTGTTCCCTCTACGTGAAGGTTCAAGTGACGCCCTTTTCTATCTATGTAGCTTGGCTCAGACACAAAGAAAACCAAAGTATCCTTGTACTTCGTGCATTCAGTTGGTTGACTTTCGATTGAGATCGACACTGATTCGTTTGGTAGTACTGTGCCGGTAGACGGTGTGATGTCAAAGGTACCAGTGGATATATTTGTTATTAAATCCAGAGCACTTTTCCCTTTTTCTTGTTGTCGCTAGATTTAGCCTTGCCTTTTCCCTTTTTCTTGTTGTCGGTCAGCGATTTCGACTTTCGATTTTGATTTACGACTTCTTCTTGAGGTACGGACTCAGAAGGTGCAGAAGGTATACTGCTCAATTTTTCAGTTTCTTCCGCTTGAGTAACTTCTTTCTTGCTAAGTTTTCTAAGAGCTTGTTCTTCTATCATAGCTGGTGTCATTATTGTATATTTGAATTCAAAGAATCCAGTGTTCTTCAAGGTTAACAAGCTGGAACGAGTGGTGTTGATGTTTTGATAGCCGAAAAAGTATTCTCCATGTGGGCAGAGCTCGAACTTGGAAAGTGCCACCTTTGCTGACGCTCTGAATGTGAAATGGTCTATAGCTGAATTTCTATAGTTGTCCAGAATCGTTACGTGAACAACGGGAATATCAACAAAACTCAATTCTTTGTTACATGTGAATCTGCAATTGTTAGAATACTTCGAAGCTCCTTCCACCACGTACTCCATATGTTTCATCTTGAAAAAGTCTCCGATCGAAGGGTGACCGCCTTGTTGTTGTGGTTTTGTTAATAATATCTTCACATCATATTTGCCCAGGTTATTGATCGTGAATGGGAAGAAATGTGGAACTTTGCCTTTCACTAGACCTAAATTGATACTTGTCTCATATTCCAGAGGGAAAGTAGCCACTTCTGCA
>TRINITY_DN115_c0_g1
AGAAAGTAAAGGCAAGAAAACCACCGATGTAATGACGCAGGACCTATTGTGCAGTTATTAAAATTCATGACATTTTTTCAAAAGATTGCGTATGTAGATTTTTGCTTATTTTGAGACAATTCTCTTCAGGAAACTCCTTTAAAAATAATAAATGCAATCTTTAAAAATTCGATTGTCCTTACCTATATGTTGCTACCAAATCATGACAAATTTGCTTATTCACATGTCTACTTTTCCTGATTATTATATCTCATATACTCGTTTAAAAATAAT
>TRINITY_DN41_c0_g1
CCGGGGGACGCATTCATCTCTAAGTGCAAGTGTTGAACCAAACTAGTAAAATGAGCTCAAGAATTATCTGCCTTACTCTCCTCTTCGCCATTTTCCTGGAACTTGGCTTTTGTCAATCACCAGACCAAATGGCTCAAAATGTTGCTAGCAAGATGACTTCAGCCATGGGAAGTGTTCCAATACCTGGAGCCCAGCAAGCTGCTGGTGCCATGCAAACTGGTCTCGATATGGCCAAAAAATTCGTCAAAGAAGGACAACAAACAGCAGAGAAGGCCTTGGAAATGGGAATGAAACAAATGAATCACTAAATTTTAGATAGATTTCGACAAATTTCGTTGTTTGTTGGTTTCGAAATATGTACTAAAAAATAAATCAATTAACG
>TRINITY_DN114_c5_g1
TGTAAAGAGATCTCGCGATATATACTTTTTTCGCATTCTTCTCTCTCCAGAATACATTGCAGATACGTTCATGCAGATCGATTTGTCTATCGTAGTCGGACAAGAAGATCTCTGTGAGAAAACTCGATGCATTCTGAATGAAGAACGATTCCTCCAAAGGGGGCGAGTATTGTAATACGGGAGGGAACTGCACCAGGCTCTCTTTGATCACAAAATTCGGTTCTCGACCGTACCCGTTCAGGTAGGCGGTCAAGTCTTCATGATTTCCCTCAACGTGAAAAGTCATGATTCCTTGTTTTGGACCTCTCGTCTTCGGCTCGAAGAAGACCTGCAACTCTTCGGATTCGCCAGCAGATAGAACGCCTTCTTTTTTCCTGACGAAGAATATCGGCGTGTCTATGGTGCAGCTCCATTTGGCATCAACGAACCCTACATTGTAGAGGCACAATATTTTCCTTTTACAACTACCCACGATCACACCGCAGAAATCCATACAATGTTTATTAAGCTCTGTGGTGGGAATGCCTACCGAGGCACTGATTTTAATAGGAATTCGAGCTCCTTGATTCACCTCGATATAAAACACCTCCGATATATGGGGATTAGAAAAATCAGCACCCTTCACATCAGGTCGAAACTTGACGTTCAAAGTGCAAAATTCTCTCAGTTTAATCCTCTGGCAGTCCAGCGTCACGAAGAATCCTCTCCCTTCAATAGTTTTCTTGTCCGTTATGAACAACCTGAGCAGACACAATCCAGGACCGTAATTATAAAGGGTAACATTCTGTTCGTACTGGCCATCACGTCTGACATTACCAAAGCAAAGTTCGTAAGCTGGCACCAAGTAATTTGGTATCGTGAAGTGCCTCTTCCTGATGCTGACTCTTTCTCCCAATAATTGGGGATTATTTTGGAGGAATTCGTGGCCAATCATCCTTTCAATGGCCATGTCTATGTCTACTGCAGATGGAATGTTGGGGTCATCGTATTCAACAATATACCAATCTTCCTGTTCCAAGATAGCAGTGGTAATTTCATCCAGTCTGGAATCACTTGAGCTACATTTCATGTTGTAATGCAGATGACTCAGGTCCCTTGACAAGTATCCTATAGCGGTATAACATGAAAACGCCTCGGCAGCTTCGAACAAACTTGGACGTGGTAGCATAATATACAGTTGGGAGTATACAGCTGTTCCGCTCACTCTGATAGATGTGGGACTCAAATAACCAATTTCTACAACGAAGGATTCATTGAAATCTCCAGTGATTCCTGGAAAATATTTCACTAGTAGCAAAGCGTTTTCACCAG
>TRINITY_DN173_c0_g1
TTAAAATTCAGTTAACACAATAATTCAAGCCGGTCAATCAAAATGATCCAGAATTTCTCTAAAATCATAGTCAGTGATGAGGCCCATTTTCATCTTGGAGGCTCTTGGCATTGGAAATTTTTTTTATCCACCTAACCACGTAGATGGAAGTCGATAACTCTCTACACAACTTGGGAATGTGATTTTCCAGCTCACATTTGACTCGAATTCTACCTCTAAATATGTAGATAATAGTCTAG