File: genewisedb-pfam.out

package info (click to toggle)
wise 2.4.1-21
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, buster, sid
  • size: 27,140 kB
  • sloc: ansic: 276,365; makefile: 1,003; perl: 886; lex: 93; yacc: 81; sh: 24
file content (157 lines) | stat: -rw-r--r-- 7,298 bytes parent folder | download
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
Wise2 - database searching mode
Program: genewisedb version: $Name: wise2-4-1 $ released: unreleased
This program is freely distributed under a GNU General Public License.
   See -version for more info on copyright
Bugs and credits to Ewan Birney <birney@sanger.ac.uk>
-----------------------------------------------------

Algorithm type:        GeneWise
Search algorithm used: 623
Implementation:        Single Threaded processor (serial)
Search mode:           Single genomic vs protein db
Protein info from:     rrm.HMM
Dna info from:         short.dna
Start/End (protein)    default
Gene Paras:            /usr/share/wise/human.gf
Codon Table:           /usr/share/wise/codon.table
Subs error:            1e-05
Indel error:           1e-05
Model splice?          model
Model codon bias?      flat
Model intron bias?     tied
Null model             syn
Alignment Alg          623L

#
#WARNING!
#
# Your alignment algorithm is different from your search algorithm.
# This is probably quite sensible but will lead to differing scores.
# Use the search score as an indicator of the significance of the match
# Read the docs for more information
#


#High Score list
#Protein ID                 DNA Str  ID                        Bits Evalue
--------------------------------------------------------------------------
Protein SEED                DNA [+] HSHNCPA1                 100.94


#Alignments
-----------------------------------------------------------------------

>Results for SEED vs HSHNCPA1 (forward) [0]

genewisedb output
Score 92.71 bits over entire alignment.
This will be different from per-alignment scores. See manual for details
For computer parsable output, try genewisedb -help or read the manual
Scores as bits over a synchronous coding model

                                                                       
                                                                       
                                                                       
                                                                       
                                                                       
                     Alignment 1 Score 92.71 (Bits)                    


SEED               1 LFVGNLPPDVTEEDLKDLFSKFGPIVSIKIVRDIIEKPKETGKSKGFAF 
                      FVG++ +D+ E+ L+D+F+++G+I+ I+I++D     +  GK +GFA+ 
                     IFVGGIKEDTEEHHLRDYFEQYGKIEVIEIMTD-----RGSGKKRGFAx 
HSHNCPA1          17 atgggaaggaggcccagttgctgaaggagaaag     cgagaaagtgt 
                     tttggtaaacaaaatgaataaagatattattca     ggggaaggtct 
                     atttctaactaatcaatttagtaatagtacgtc     actcgagctcN 


SEED              50 VEFESEEDAEKALEALNGKELGGRKLRV                      
                     V+F+++++++K +     ++++G++++V                      
                     VTFDDHDSVDKIVI-QKYHTVNGHNCEV                      
HSHNCPA1         149 gatggcgtggaaga catcagagcatgg                      
                     tctaaaactaattt aaaactagaagat                      
                     actcctccgtgtct gacttgtccctat                      


//
0.00 [-1:-1 "LOOP_STATE" 0],[0:15 "RANDOM_SEQUENCE" 0]
-5.85 [-1:0 "MATCH_STATE" -2026],[15:18 "CODON" -2026]
3.21 [0:1 "MATCH_STATE" 1114],[18:21 "CODON" 1114]
3.13 [1:2 "MATCH_STATE" 1086],[21:24 "CODON" 1086]
2.46 [2:3 "MATCH_STATE" 853],[24:27 "CODON" 853]
1.79 [3:4 "MATCH_STATE" 621],[27:30 "CODON" 621]
0.64 [4:5 "MATCH_STATE" 223],[30:33 "CODON" 223]
-0.58 [5:6 "MATCH_STATE" -202],[33:36 "CODON" -202]
0.63 [6:7 "MATCH_STATE" 218],[36:39 "CODON" 218]
2.41 [7:8 "MATCH_STATE" 834],[39:42 "CODON" 834]
1.73 [8:9 "MATCH_STATE" 600],[42:45 "CODON" 600]
-1.19 [9:10 "MATCH_STATE" -414],[45:48 "CODON" -414]
2.48 [10:11 "MATCH_STATE" 859],[48:51 "CODON" 859]
0.49 [11:12 "MATCH_STATE" 171],[51:54 "CODON" 171]
-0.94 [12:13 "MATCH_STATE" -326],[54:57 "CODON" -326]
2.82 [13:14 "MATCH_STATE" 978],[57:60 "CODON" 978]
1.79 [14:15 "MATCH_STATE" 622],[60:63 "CODON" 622]
2.12 [15:16 "MATCH_STATE" 736],[63:66 "CODON" 736]
1.19 [16:17 "MATCH_STATE" 413],[66:69 "CODON" 413]
4.21 [17:18 "MATCH_STATE" 1458],[69:72 "CODON" 1458]
0.97 [18:19 "MATCH_STATE" 335],[72:75 "CODON" 335]
1.71 [19:20 "MATCH_STATE" 591],[75:78 "CODON" 591]
2.81 [20:21 "MATCH_STATE" 975],[78:81 "CODON" 975]
3.51 [21:22 "MATCH_STATE" 1215],[81:84 "CODON" 1215]
1.33 [22:23 "MATCH_STATE" 460],[84:87 "CODON" 460]
2.71 [23:24 "MATCH_STATE" 940],[87:90 "CODON" 940]
1.19 [24:25 "MATCH_STATE" 413],[90:93 "CODON" 413]
-2.42 [25:26 "MATCH_STATE" -838],[93:96 "CODON" -838]
2.22 [26:27 "MATCH_STATE" 768],[96:99 "CODON" 768]
0.51 [27:28 "MATCH_STATE" 176],[99:102 "CODON" 176]
2.16 [28:29 "MATCH_STATE" 749],[102:105 "CODON" 749]
1.94 [29:30 "MATCH_STATE" 672],[105:108 "CODON" 672]
0.77 [30:31 "MATCH_STATE" 268],[108:111 "CODON" 268]
2.97 [31:32 "MATCH_STATE" 1028],[111:114 "CODON" 1028]
-0.05 [32:33 "DELETE_STATE" -18],[114:114 "INSERT" -18]
-0.07 [33:34 "DELETE_STATE" -24],[114:114 "INSERT" -24]
-0.05 [34:35 "DELETE_STATE" -18],[114:114 "INSERT" -18]
-0.05 [35:36 "DELETE_STATE" -18],[114:114 "INSERT" -18]
-0.05 [36:37 "DELETE_STATE" -19],[114:114 "INSERT" -19]
0.68 [37:38 "MATCH_STATE" 234],[114:117 "CODON" 234]
-0.64 [38:39 "MATCH_STATE" -221],[117:120 "CODON" -221]
-0.05 [39:40 "MATCH_STATE" -18],[120:123 "CODON" -18]
2.51 [40:41 "MATCH_STATE" 870],[123:126 "CODON" 870]
1.94 [41:42 "MATCH_STATE" 673],[126:129 "CODON" 673]
-0.47 [42:43 "MATCH_STATE" -162],[129:132 "CODON" -162]
2.27 [43:44 "MATCH_STATE" 788],[132:135 "CODON" 788]
3.24 [44:45 "MATCH_STATE" 1122],[135:138 "CODON" 1122]
3.06 [45:46 "MATCH_STATE" 1062],[138:141 "CODON" 1062]
2.52 [46:47 "MATCH_STATE" 872],[141:144 "CODON" 872]
3.24 [47:48 "MATCH_STATE" 1122],[144:147 "CODON" 1122]
3.30 [48:49 "MATCH_STATE" 1144],[147:150 "CODON" 1144]
1.31 [49:50 "MATCH_STATE" 455],[150:153 "CODON" 455]
4.00 [50:51 "MATCH_STATE" 1386],[153:156 "CODON" 1386]
1.16 [51:52 "MATCH_STATE" 401],[156:159 "CODON" 401]
1.92 [52:53 "MATCH_STATE" 665],[159:162 "CODON" 665]
1.50 [53:54 "MATCH_STATE" 519],[162:165 "CODON" 519]
1.62 [54:55 "MATCH_STATE" 561],[165:168 "CODON" 561]
1.28 [55:56 "MATCH_STATE" 443],[168:171 "CODON" 443]
0.02 [56:57 "MATCH_STATE" 6],[171:174 "CODON" 6]
1.00 [57:58 "MATCH_STATE" 346],[174:177 "CODON" 346]
2.33 [58:59 "MATCH_STATE" 807],[177:180 "CODON" 807]
-0.14 [59:60 "MATCH_STATE" -48],[180:183 "CODON" -48]
1.59 [60:61 "MATCH_STATE" 551],[183:186 "CODON" 551]
-0.79 [61:62 "MATCH_STATE" -275],[186:189 "CODON" -275]
-2.39 [62:63 "DELETE_STATE" -827],[189:189 "INSERT" -827]
-0.46 [63:64 "MATCH_STATE" -160],[189:192 "CODON" -160]
-0.36 [64:65 "MATCH_STATE" -125],[192:195 "CODON" -125]
-0.62 [65:66 "MATCH_STATE" -216],[195:198 "CODON" -216]
0.96 [66:67 "MATCH_STATE" 333],[198:201 "CODON" 333]
0.72 [67:68 "MATCH_STATE" 248],[201:204 "CODON" 248]
1.26 [68:69 "MATCH_STATE" 438],[204:207 "CODON" 438]
1.71 [69:70 "MATCH_STATE" 591],[207:210 "CODON" 591]
2.74 [70:71 "MATCH_STATE" 951],[210:213 "CODON" 951]
1.91 [71:72 "MATCH_STATE" 661],[213:216 "CODON" 661]
0.21 [72:73 "MATCH_STATE" 74],[216:219 "CODON" 74]
0.91 [73:74 "MATCH_STATE" 314],[219:222 "CODON" 314]
0.34 [74:75 "MATCH_STATE" 119],[222:225 "CODON" 119]
2.75 [75:76 "MATCH_STATE" 954],[225:228 "CODON" 954]
0.00 [76:0 "LOOP_STATE" 0],[228:413 "RANDOM_SEQUENCE" 0]
0.00 [0:0 "END" 0],[413:414 "END" 0]
//