1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764
|
//
// sffmultiplecommand.cpp
// Mothur
//
// Created by Sarah Westcott on 8/14/12.
// Copyright (c) 2012 Schloss Lab. All rights reserved.
//
#include "sffmultiplecommand.h"
//**********************************************************************************************************************
vector<string> SffMultipleCommand::setParameters(){
try {
CommandParameter pfile("file", "InputTypes", "", "", "none", "none", "none","fasta-name",false,true,true); parameters.push_back(pfile);
//sffinfo
CommandParameter ptrim("trim", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(ptrim);
//trim.flows
CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop);
CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows);
CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows);
CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(ppdiffs);
CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(pbdiffs);
CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pldiffs);
CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(psdiffs);
CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(ptdiffs);
CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal);
CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise);
CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder);
//shhh.flows
CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup);
CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff);
CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter);
CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge);
CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma);
CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta);
//trim.seqs parameters
CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles);
CommandParameter pflip("flip", "Boolean", "", "F", "", "", "","",false,false,true); parameters.push_back(pflip);
CommandParameter pmaxambig("maxambig", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(pmaxambig);
CommandParameter pminlength("minlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pminlength);
CommandParameter pmaxlength("maxlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pmaxlength);
CommandParameter pkeepforward("keepforward", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pkeepforward);
CommandParameter pkeepfirst("keepfirst", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pkeepfirst);
CommandParameter premovelast("removelast", "Number", "", "0", "", "", "","",false,false); parameters.push_back(premovelast);
CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
CommandParameter pseed("seed", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pseed);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
vector<string> tempOutNames;
outputTypes["fasta"] = tempOutNames;
outputTypes["name"] = tempOutNames;
outputTypes["group"] = tempOutNames;
abort = false; calledHelp = false; append=false; makeGroup=false;
vector<string> myArray;
for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
return myArray;
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "setParameters");
exit(1);
}
}
//**********************************************************************************************************************
string SffMultipleCommand::getHelpString(){
try {
string helpString = "";
helpString += "The sff.multiple command reads a file containing sff filenames and optional oligos filenames. It runs the files through sffinfo, trim.flows, shhh.flows and trim.seqs combining the results.\n";
helpString += "The sff.multiple command parameters are: ";
vector<string> parameters = setParameters();
for (int i = 0; i < parameters.size()-1; i++) {
helpString += parameters[i] + ", ";
}
helpString += parameters[parameters.size()-1] + ".\n";
helpString += "The file parameter allows you to enter the a file containing the list of sff files and optional oligos files.\n";
helpString += "The trim parameter allows you to indicate if you would like a sequences and quality scores generated by sffinfo trimmed to the clipQualLeft and clipQualRight values. Default=True. \n";
helpString += "The maxambig parameter allows you to set the maximum number of ambiguous bases allowed. The default is -1.\n";
helpString += "The maxhomop parameter allows you to set a maximum homopolymer length. \n";
helpString += "The minlength parameter allows you to set and minimum sequence length. \n";
helpString += "The maxlength parameter allows you to set and maximum sequence length. \n";
helpString += "The tdiffs parameter is used to specify the total number of differences allowed in the sequence. The default is pdiffs + bdiffs + sdiffs + ldiffs.\n";
helpString += "The bdiffs parameter is used to specify the number of differences allowed in the barcode. The default is 0.\n";
helpString += "The pdiffs parameter is used to specify the number of differences allowed in the primer. The default is 0.\n";
helpString += "The ldiffs parameter is used to specify the number of differences allowed in the linker. The default is 0.\n";
helpString += "The sdiffs parameter is used to specify the number of differences allowed in the spacer. The default is 0.\n";
helpString += "The allfiles parameter will create separate group and fasta file for each grouping. The default is F.\n";
helpString += "The keepforward parameter allows you to indicate whether you want the forward primer removed or not. The default is F, meaning remove the forward primer.\n";
helpString += "The keepfirst parameter trims the sequence to the first keepfirst number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements. \n";
helpString += "The removelast removes the last removelast number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements.\n";
helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n";
helpString += "Example sff.multiple(file=mySffOligosFile.txt, trim=F).\n";
return helpString;
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "getHelpString");
exit(1);
}
}
//**********************************************************************************************************************
string SffMultipleCommand::getOutputPattern(string type) {
try {
string pattern = "";
if (type == "fasta") { pattern = "[filename],fasta"; }
else if (type == "name") { pattern = "[filename],names"; }
else if (type == "group") { pattern = "[filename],groups"; }
else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->setControl_pressed(true); }
return pattern;
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "getOutputPattern");
exit(1);
}
}
//**********************************************************************************************************************
SffMultipleCommand::SffMultipleCommand(string option) : Command() {
try {
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else if(option == "category") { abort = true; calledHelp = true; }
else {
OptionParser parser(option, setParameters());
map<string, string> parameters = parser.getParameters();
ValidParameters validParameter;
filename = validParameter.validFile(parameters, "file");
if (filename == "not open") { filename = ""; abort = true; }
else if (filename == "not found") { filename = ""; }
string temp;
temp = validParameter.valid(parameters, "trim"); if (temp == "not found"){ temp = "T"; }
trim = util.isTrue(temp);
temp = validParameter.valid(parameters, "minflows"); if (temp == "not found") { temp = "450"; }
util.mothurConvert(temp, minFlows);
temp = validParameter.valid(parameters, "maxflows"); if (temp == "not found") { temp = "450"; }
util.mothurConvert(temp, maxFlows);
temp = validParameter.valid(parameters, "maxhomop"); if (temp == "not found"){ temp = "9"; }
util.mothurConvert(temp, maxHomoP);
temp = validParameter.valid(parameters, "signal"); if (temp == "not found"){ temp = "0.50"; }
util.mothurConvert(temp, signal);
temp = validParameter.valid(parameters, "noise"); if (temp == "not found"){ temp = "0.70"; }
util.mothurConvert(temp, noise);
temp = validParameter.valid(parameters, "bdiffs"); if (temp == "not found"){ temp = "0"; }
util.mothurConvert(temp, bdiffs);
temp = validParameter.valid(parameters, "pdiffs"); if (temp == "not found"){ temp = "0"; }
util.mothurConvert(temp, pdiffs);
temp = validParameter.valid(parameters, "ldiffs"); if (temp == "not found") { temp = "0"; }
util.mothurConvert(temp, ldiffs);
temp = validParameter.valid(parameters, "sdiffs"); if (temp == "not found") { temp = "0"; }
util.mothurConvert(temp, sdiffs);
temp = validParameter.valid(parameters, "tdiffs"); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); }
util.mothurConvert(temp, tdiffs);
if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; }
temp = validParameter.valid(parameters, "processors"); if (temp == "not found"){ temp = current->getProcessors(); }
processors = current->setProcessors(temp);
temp = validParameter.valid(parameters, "order"); if (temp == "not found"){ temp = "A"; }
if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
}
else {
if (toupper(temp[0]) == 'A') { flowOrder = "A"; }
else if(toupper(temp[0]) == 'B'){
flowOrder = "B"; }
else if(toupper(temp[0]) == 'I'){
flowOrder = "I"; }
else {
m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
}
}
temp = validParameter.valid(parameters, "cutoff"); if (temp == "not found"){ temp = "0.01"; }
util.mothurConvert(temp, cutoff);
temp = validParameter.valid(parameters, "mindelta"); if (temp == "not found"){ temp = "0.000001"; }
minDelta = temp;
temp = validParameter.valid(parameters, "maxiter"); if (temp == "not found"){ temp = "1000"; }
util.mothurConvert(temp, maxIters);
temp = validParameter.valid(parameters, "large"); if (temp == "not found"){ temp = "0"; }
util.mothurConvert(temp, largeSize);
if (largeSize != 0) { large = true; }
else { large = false; }
if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); }
temp = validParameter.valid(parameters, "sigma");if (temp == "not found") { temp = "60"; }
util.mothurConvert(temp, sigma);
temp = validParameter.valid(parameters, "flip");
if (temp == "not found") { flip = 0; }
else { flip = util.isTrue(temp); }
temp = validParameter.valid(parameters, "maxambig"); if (temp == "not found") { temp = "-1"; }
util.mothurConvert(temp, maxAmbig);
temp = validParameter.valid(parameters, "minlength"); if (temp == "not found") { temp = "0"; }
util.mothurConvert(temp, minLength);
temp = validParameter.valid(parameters, "maxlength"); if (temp == "not found") { temp = "0"; }
util.mothurConvert(temp, maxLength);
temp = validParameter.valid(parameters, "keepfirst"); if (temp == "not found") { temp = "0"; }
convert(temp, keepFirst);
temp = validParameter.valid(parameters, "removelast"); if (temp == "not found") { temp = "0"; }
convert(temp, removeLast);
temp = validParameter.valid(parameters, "allfiles"); if (temp == "not found") { temp = "F"; }
allFiles = util.isTrue(temp);
temp = validParameter.valid(parameters, "keepforward"); if (temp == "not found") { temp = "F"; }
keepforward = util.isTrue(temp);
temp = validParameter.validFile(parameters, "lookup");
if (temp == "not found") {
string path = current->getProgramPath();
//string tempPath = path;
//for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
//path = path.substr(0, (tempPath.find_last_of('m')));
#if defined NON_WINDOWS
path += "lookupFiles/";
#else
path += "lookupFiles\\";
#endif
lookupFileName = util.getFullPathName(path) + "LookUp_Titanium.pat";
bool ableToOpen = util.checkLocations(lookupFileName, current->getLocations());
if (!ableToOpen) { abort=true; }
}else if(temp == "not open") {
lookupFileName = validParameter.validPath(parameters, "lookup");
//if you can't open it its not inputDir, try mothur excutable location
string exepath = current->getProgramPath();
//string tempPath = exepath;
//for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
//exepath = exepath.substr(0, (tempPath.find_last_of('m')));
string tryPath = util.getFullPathName(exepath) + util.getSimpleName(lookupFileName);
m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
ifstream in2;
bool ableToOpen = util.openInputFile(tryPath, in2, "noerror");
in2.close();
lookupFileName = tryPath;
if (!ableToOpen) { m->mothurOut("Unable to open " + lookupFileName + ".\n"); abort=true; }
}else { lookupFileName = temp; }
}
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
exit(1);
}
}
//**********************************************************************************************************************
int SffMultipleCommand::execute(){
try {
if (abort) { if (calledHelp) { return 0; } return 2; }
vector<string> sffFiles, oligosFiles;
readFile(sffFiles, oligosFiles);
string thisOutputDir = outputdir;
if (thisOutputDir == "") { thisOutputDir = util.hasPath(filename); }
string fileroot = thisOutputDir + util.getRootName(util.getSimpleName(filename));
map<string, string> variables;
variables["[filename]"] = fileroot;
string fasta = getOutputFileName("fasta",variables);
string name = getOutputFileName("name",variables);
string group = getOutputFileName("group",variables);
if (m->getControl_pressed()) { return 0; }
if (sffFiles.size() < processors) { processors = sffFiles.size(); m->mothurOut("Reducing processors to " + toString(sffFiles.size()) + ".\n"); }
createProcesses(sffFiles, oligosFiles, fasta, name, group);
if (m->getControl_pressed()) { for (int i = 0; i < outputNames.size(); i++) { util.mothurRemove(outputNames[i]); } return 0; }
if (append) {
outputNames.push_back(fasta); outputTypes["fasta"].push_back(fasta);
current->setFastaFile(fasta);
outputNames.push_back(name); outputTypes["name"].push_back(name);
current->setNameFile(name);
if (makeGroup) { outputNames.push_back(group); outputTypes["group"].push_back(group); current->setGroupFile(group); }
}
current->setProcessors(toString(processors));
//report output filenames
m->mothurOut("\nOutput File Names: \n");
for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i] +"\n"); } m->mothurOutEndLine();
return 0;
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "execute");
exit(1);
}
}
//**********************************************************************************************************************
int SffMultipleCommand::readFile(vector<string>& sffFiles, vector<string>& oligosFiles){
try {
ifstream in; util.openInputFile(filename, in);
bool allBlank = true; bool allFull = true;
string oligos, sff;
while (!in.eof()) {
if (m->getControl_pressed()) { break; }
in >> sff;
//ignore file pairing
if(sff[0] == '#'){ while (!in.eof()) { char c = in.get(); if (c == 10 || c == 13){ break; } } gobble(in); }
else { //check for oligos file
bool ableToOpenSff = util.checkLocations(sff, current->getLocations());
oligos = "";
// get rest of line in case there is a oligos filename
while (!in.eof()) {
char c = in.get();
if (c == 10 || c == 13 || c == -1){ break; }
else if (c == 32 || c == 9){;} //space or tab
else { oligos += c; }
}
if (ableToOpenSff) {
sffFiles.push_back(sff);
if (oligos != "") {
bool ableToOpenOligos = util.checkLocations(oligos, current->getLocations());
if (ableToOpenOligos) { allBlank = false; }
else { m->mothurOut("Can not find " + oligos + ". Ignoring.\n"); oligos = ""; }
}
if (oligos == "") { allFull = false; }
oligosFiles.push_back(oligos); //will push a blank if there is not an oligos for this sff file
}else { m->mothurOut("Can not find " + sff + ". Ignoring.\n"); }
}
gobble(in);
}
in.close();
if (allBlank || allFull) { append = true; }
if (allFull) { makeGroup = true; }
return 0;
}
catch(exception& e) {
m->errorOut(e, "SffMultipleCommand", "readFile");
exit(1);
}
}
//**********************************************************************************************************************
void mergeOutputFileList(map<string, vector<string> >& files, map<string, vector<string> >& temp){
map<string, vector<string> >::iterator it;
for (it = temp.begin(); it != temp.end(); it++) {
map<string, vector<string> >::iterator it2 = files.find(it->first);
if (it2 == files.end()) { //we do not already have this type so just add it
files[it->first] = it->second;
}else { //merge them
for (int i = 0; i < (it->second).size(); i++) {
files[it->first].push_back((it->second)[i]);
}
}
}
}
/**************************************************************************************************/
struct sffMultipleData {
string fasta, name, group;
vector<string> sffFiles, oligosFiles;
int start, end;
MothurOut* m;
Utils util;
int count;
string flowOrder, lookupFileName, minDelta;
bool trim, large, flip, allFiles, keepforward, append, makeGroup;
int maxFlows, minFlows, minLength, maxLength, maxHomoP, tdiffs, bdiffs, pdiffs, sdiffs, ldiffs;
int maxIters, largeSize;
float signal, noise, cutoff, sigma;
int keepFirst, removeLast, maxAmbig;
vector<string> outputNames;
map<string, vector<string> > outputTypes;
sffMultipleData(){}
sffMultipleData(vector<string> sFiles, vector<string> oFiles, string fa, string nm, string grp, int st, int en) {
sffFiles = sFiles;
oligosFiles = oFiles;
fasta = fa;
name = nm;
group = grp;
start = st;
end = en;
m = MothurOut::getInstance();
count = 0;
}
void setVariables(bool tr, bool lg, bool alf, bool flp, bool kpfo, bool mkg, bool app, int lgs, int bd, int td, int pd, int sd, int ld, int mxf, int mnf, int mnl, int mxl, int mxh, int mxi, int kpf, int rml, float sgn, float n, float cu, float sig, string fo, string lkf, string mnd) {
trim = tr;
large = lg;
allFiles = alf;
keepforward = kpfo;
flip = flp;
makeGroup = mkg;
append = app;
largeSize = lgs;
tdiffs = td;
bdiffs = bd;
pdiffs = pd;
sdiffs = sd;
ldiffs = ld;
maxFlows = mxf;
minFlows = mnf;
minLength = mnl;
maxLength = mxl;
maxHomoP = mxh;
maxIters = mxi;
signal = sgn;
noise = n;
cutoff = cu;
sigma = sig;
flowOrder = fo;
lookupFileName = lkf;
minDelta = mnd;
keepFirst = kpf;
removeLast = rml;
}
};
//**********************************************************************************************************************
//runs sffinfo, summary.seqs, trim.flows, shhh.flows, trim.seqs, summary.seqs for each sff file.
void driverSFFMultiple(sffMultipleData* params){
try {
params->util.mothurRemove(params->fasta); params->util.mothurRemove(params->name); params->util.mothurRemove(params->group);
params->count = 0;
for (int s = params->start; s < params->end; s++) {
string sff = params->sffFiles[s];
string oligos = params->oligosFiles[s];
params->m->mothurOut("\n>>>>>\tProcessing " + sff + " (file " + toString(s+1) + " of " + toString(params->sffFiles.size()) + ")\t<<<<<\n");
//run sff.info
string inputString = "sff=" + sff + ", flow=T";
if (params->trim) { inputString += ", trim=T"; }
params->m->mothurOut("/******************************************/\n");
params->m->mothurOut("Running command: sffinfo(" + inputString + ")\n");
Command* sffCommand = new SffInfoCommand(inputString);
sffCommand->execute();
if (params->m->getControl_pressed()){ break; }
map<string, vector<string> > filenames = sffCommand->getOutputFiles();
delete sffCommand;
params->m->mothurOutEndLine();
//run summary.seqs on the fasta file
string fastaFile = "";
map<string, vector<string> >::iterator it = filenames.find("fasta");
if (it != filenames.end()) { if ((it->second).size() != 0) { fastaFile = (it->second)[0]; } }
else { params->m->mothurOut("[ERROR]: sffinfo did not create a fasta file, quitting.\n"); params->m->setControl_pressed(true); break; }
inputString = "fasta=" + fastaFile + ", processors=1";
params->m->mothurOut("\nRunning command: summary.seqs(" + inputString + ")\n");
Command* summarySeqsCommand = new SeqSummaryCommand(inputString);
summarySeqsCommand->execute();
if (params->m->getControl_pressed()){ break; }
map<string, vector<string> > temp = summarySeqsCommand->getOutputFiles();
mergeOutputFileList(filenames, temp);
delete summarySeqsCommand;
params->m->mothurOutEndLine();
//run trim.flows on the fasta file
string flowFile = "";
it = filenames.find("flow");
if (it != filenames.end()) { if ((it->second).size() != 0) { flowFile = (it->second)[0]; } }
else { params->m->mothurOut("[ERROR]: sffinfo did not create a flow file, quitting.\n"); params->m->setControl_pressed(true); break; }
inputString = "flow=" + flowFile;
if (oligos != "") { inputString += ", oligos=" + oligos; }
inputString += ", maxhomop=" + toString(params->maxHomoP) + ", maxflows=" + toString(params->maxFlows) + ", minflows=" + toString(params->minFlows);
inputString += ", pdiffs=" + toString(params->pdiffs) + ", bdiffs=" + toString(params->bdiffs) + ", ldiffs=" + toString(params->ldiffs) + ", sdiffs=" + toString(params->sdiffs);
inputString += ", tdiffs=" + toString(params->tdiffs) + ", signal=" + toString(params->signal) + ", noise=" + toString(params->noise) + ", order=" + params->flowOrder + ", processors=1";
params->m->mothurOut("\nRunning command: trim.flows(" + inputString + ")\n");
Command* trimFlowCommand = new TrimFlowsCommand(inputString);
trimFlowCommand->execute();
if (params->m->getControl_pressed()){ break; }
temp = trimFlowCommand->getOutputFiles();
mergeOutputFileList(filenames, temp);
delete trimFlowCommand;
string fileFileName = "";
flowFile = "";
if (oligos != "") {
it = temp.find("file");
if (it != temp.end()) { if ((it->second).size() != 0) { fileFileName = (it->second)[0]; } }
else { params->m->mothurOut("[ERROR]: trim.flows did not create a file file, quitting.\n"); params->m->setControl_pressed(true); break; }
}else {
vector<string> flowFiles;
it = temp.find("flow");
if (it != temp.end()) { if ((it->second).size() != 0) { flowFiles = (it->second); } }
else { params->m->mothurOut("[ERROR]: trim.flows did not create a flow file, quitting.\n"); params->m->setControl_pressed(true); break; }
for (int i = 0; i < flowFiles.size(); i++) {
string end = flowFiles[i].substr(flowFiles[i].length()-9);
if (end == "trim.flow") {
flowFile = flowFiles[i]; i+=flowFiles.size(); //if we found the trim.flow file stop looking
}
}
}
if ((fileFileName == "") && (flowFile == "")) { params->m->mothurOut("[ERROR]: trim.flows did not create a file file or a trim.flow file, quitting.\n"); params->m->setControl_pressed(true); break; }
if (fileFileName != "") { inputString = "file=" + fileFileName; }
else { inputString = "flow=" + flowFile; }
inputString += ", lookup=" + params->lookupFileName + ", cutoff=" + toString(params->cutoff); + ", maxiters=" + toString(params->maxIters);
if (params->large) { inputString += ", large=" + toString(params->largeSize); }
inputString += ", sigma=" +toString(params->sigma);
inputString += ", mindelta=" + toString(params->minDelta);
inputString += ", order=" + params->flowOrder;
//run shhh.flows
params->m->mothurOut("\nRunning command: shhh.flows(" + inputString + ")\n");
Command* shhhFlowCommand = new ShhherCommand(inputString);
shhhFlowCommand->execute();
if (params->m->getControl_pressed()){ break; }
temp = shhhFlowCommand->getOutputFiles();
mergeOutputFileList(filenames, temp);
delete shhhFlowCommand;
vector<string> fastaFiles;
vector<string> nameFiles;
it = temp.find("fasta");
if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
else { params->m->mothurOut("[ERROR]: shhh.flows did not create a fasta file, quitting.\n"); params->m->setControl_pressed(true); break; }
it = temp.find("name");
if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
else { params->m->mothurOut("[ERROR]: shhh.flows did not create a name file, quitting.\n"); params->m->setControl_pressed(true); break; }
//find fasta and name files with the shortest name. This is because if there is a composite name it will be the shortest.
fastaFile = fastaFiles[0];
for (int i = 1; i < fastaFiles.size(); i++) { if (fastaFiles[i].length() < fastaFile.length()) { fastaFile = fastaFiles[i]; } }
string nameFile = nameFiles[0];
for (int i = 1; i < nameFiles.size(); i++) { if (nameFiles[i].length() < nameFile.length()) { nameFile = nameFiles[i]; } }
inputString = "fasta=" + fastaFile + ", name=" + nameFile;
if (oligos != "") { inputString += ", oligos=" + oligos; }
if (params->allFiles) { inputString += ", allfiles=t"; }
else { inputString += ", allfiles=f"; }
if (params->flip) { inputString += ", flip=t"; }
else { inputString += ", flip=f"; }
if (params->keepforward) { inputString += ", keepforward=t"; }
else { inputString += ", keepforward=f"; }
inputString += ", pdiffs=" + toString(params->pdiffs) + ", bdiffs=" + toString(params->bdiffs) + ", ldiffs=" + toString(params->ldiffs) + ", sdiffs=" + toString(params->sdiffs);
inputString += ", tdiffs=" + toString(params->tdiffs) + ", maxambig=" + toString(params->maxAmbig) + ", minlength=" + toString(params->minLength) + ", maxlength=" + toString(params->maxLength);
if (params->keepFirst != 0) { inputString += ", keepfirst=" + toString(params->keepFirst); }
if (params->removeLast != 0) { inputString += ", removelast=" + toString(params->removeLast); }
inputString += ", processors=1";
//run trim.seqs
params->m->mothurOut("\nRunning command: trim.seqs(" + inputString + ")\n");
Command* trimseqsCommand = new TrimSeqsCommand(inputString);
trimseqsCommand->execute();
if (params->m->getControl_pressed()){ break; }
temp = trimseqsCommand->getOutputFiles();
mergeOutputFileList(filenames, temp);
delete trimseqsCommand;
it = temp.find("fasta");
if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
else { params->m->mothurOut("[ERROR]: trim.seqs did not create a fasta file, quitting.\n"); params->m->setControl_pressed(true); break; }
for (int i = 0; i < fastaFiles.size(); i++) {
string end = fastaFiles[i].substr(fastaFiles[i].length()-10);
if (end == "trim.fasta") {
fastaFile = fastaFiles[i]; i+=fastaFiles.size(); //if we found the trim.fasta file stop looking
}
}
it = temp.find("name");
if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
else { params->m->mothurOut("[ERROR]: trim.seqs did not create a name file, quitting.\n"); params->m->setControl_pressed(true); break; }
for (int i = 0; i < nameFiles.size(); i++) {
string end = nameFiles[i].substr(nameFiles[i].length()-10);
if (end == "trim.names") {
nameFile = nameFiles[i]; i+=nameFiles.size(); //if we found the trim.names file stop looking
}
}
vector<string> groupFiles;
string groupFile = "";
if (params->makeGroup) {
it = temp.find("group");
if (it != temp.end()) { if ((it->second).size() != 0) { groupFiles = (it->second); } }
//find group file with the shortest name. This is because if there is a composite group file it will be the shortest.
groupFile = groupFiles[0];
for (int i = 1; i < groupFiles.size(); i++) { if (groupFiles[i].length() < groupFile.length()) { groupFile = groupFiles[i]; } }
}
inputString = "fasta=" + fastaFile + ", processors=1, name=" + nameFile;
params->m->mothurOut("\nRunning command: summary.seqs(" + inputString + ")\n");
summarySeqsCommand = new SeqSummaryCommand(inputString);
summarySeqsCommand->execute();
if (params->m->getControl_pressed()){ break; }
temp = summarySeqsCommand->getOutputFiles();
mergeOutputFileList(filenames, temp);
delete summarySeqsCommand;
params->m->mothurOut("\n/******************************************/\n");
if (params->append) {
params->util.appendFiles(fastaFile, params->fasta);
params->util.appendFiles(nameFile, params->name);
if (params->makeGroup) { params->util.appendFiles(groupFile, params->group); }
}
for (it = filenames.begin(); it != filenames.end(); it++) {
for (int i = 0; i < (it->second).size(); i++) { params->outputNames.push_back((it->second)[i]); params->outputTypes[it->first].push_back((it->second)[i]); }
}
params->count++;
}
}
catch(exception& e) {
params->m->errorOut(e, "SffMultipleCommand", "driver");
exit(1);
}
}
//**********************************************************************************************************************
long long SffMultipleCommand::createProcesses(vector<string> sffFiles, vector<string> oligosFiles, string fasta, string name, string group){
try {
#if defined NON_WINDOWS
#else
//trim.flows, shhh.flows cannot handle multiple processors for windows.
processors = 1; m->mothurOut("This command can only use 1 processor on Windows platforms, using 1 processors.\n\n");
#endif
current->setMothurCalling(true);
//divide the groups between the processors
vector<linePair> lines;
vector<int> numFilesToComplete;
int numFilesPerProcessor = sffFiles.size() / processors;
for (int i = 0; i < processors; i++) {
int startIndex = i * numFilesPerProcessor;
int endIndex = (i+1) * numFilesPerProcessor;
if(i == (processors - 1)){ endIndex = sffFiles.size(); }
lines.push_back(linePair(startIndex, endIndex));
numFilesToComplete.push_back((endIndex-startIndex));
}
//create array of worker threads
vector<std::thread*> workerThreads;
vector<sffMultipleData*> data;
//Lauch worker threads
for (int i = 0; i < processors-1; i++) {
string extension = toString(i+1);
sffMultipleData* dataBundle = new sffMultipleData(sffFiles, oligosFiles, fasta+extension, name+extension, group+extension, lines[i+1].start, lines[i+1].end);
dataBundle->setVariables(trim, large, allFiles, flip, keepforward, makeGroup, append, largeSize, bdiffs, tdiffs, pdiffs, sdiffs, ldiffs, maxFlows, minFlows, minLength, maxLength, maxHomoP, maxIters, keepFirst, removeLast, signal, noise, cutoff, sigma, flowOrder, lookupFileName, minDelta);
data.push_back(dataBundle);
workerThreads.push_back(new std::thread(driverSFFMultiple, dataBundle));
}
sffMultipleData* dataBundle = new sffMultipleData(sffFiles, oligosFiles, fasta, name, group, lines[0].start, lines[0].end);
dataBundle->setVariables(trim, large, allFiles, flip, keepforward, makeGroup, append, largeSize, bdiffs, tdiffs, pdiffs, sdiffs, ldiffs, maxFlows, minFlows, minLength, maxLength, maxHomoP, maxIters, keepFirst, removeLast, signal, noise, cutoff, sigma, flowOrder, lookupFileName, minDelta);
driverSFFMultiple(dataBundle);
long long num = dataBundle->count;
outputNames = dataBundle->outputNames;
outputTypes = dataBundle->outputTypes;
for (int i = 0; i < processors-1; i++) {
workerThreads[i]->join();
num += data[i]->count;
outputNames.insert(outputNames.end(), data[i]->outputNames.begin(), data[i]->outputNames.end());
outputTypes.insert(data[i]->outputTypes.begin(), data[i]->outputTypes.end());
if (append) {
string extension = toString(i+1);
util.appendFiles(fasta+extension, fasta); util.mothurRemove(fasta+extension);
util.appendFiles(name+extension, name); util.mothurRemove(name+extension);
if (makeGroup) { util.appendFiles(group+extension, group); util.mothurRemove(group+extension); }
}
delete data[i];
delete workerThreads[i];
}
delete dataBundle;
current->setMothurCalling(false);
return num;
}
catch(exception& e) {
m->errorOut(e, "ShhherCommand", "createProcesses");
exit(1);
}
}
//**********************************************************************************************************************
|