File: misc_rna_as_sanger.fastq

package info (click to toggle)
python-biopython 1.59-1
  • links: PTS, VCS
  • area: main
  • in suites: wheezy
  • size: 32,800 kB
  • sloc: python: 116,625; xml: 39,183; ansic: 8,824; sql: 1,488; makefile: 151
file content (16 lines) | stat: -rw-r--r-- 774 bytes parent folder | download | duplicates (84)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA
+
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI
@FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg
+
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI
@FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order)
ucagucagucagucagucagucagucagucagucagucagu
+
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI
@FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled)
gaucrywsmkhbvdnGAUCRYWSMKHBVDN
+
DEFGHIDEFGHIDEFGHIDEFGHIDEFGHI