1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
|
<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>BLASTN 2.2.12 [Aug-07-2005]</BlastOutput_version>
<BlastOutput_reference>Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
<BlastOutput_db>nr</BlastOutput_db>
<BlastOutput_query-ID>gi|1348916|gb|G26684.1|G26684</BlastOutput_query-ID>
<BlastOutput_query-def>human STS STS_D11570, sequence tagged site</BlastOutput_query-def>
<BlastOutput_query-len>285</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>1</Parameters_sc-match>
<Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
<Parameters_gap-open>5</Parameters_gap-open>
<Parameters_gap-extend>2</Parameters_gap-extend>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_query-ID>gi|1348916|gb|G26684.1|G26684</Iteration_query-ID>
<Iteration_query-def>human STS STS_D11570, sequence tagged site</Iteration_query-def>
<Iteration_query-len>285</Iteration_query-len>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gi|9950606|gb|AE004854.1|</Hit_id>
<Hit_def>Pseudomonas aeruginosa PAO1, section 415 of 529 of the complete genome</Hit_def>
<Hit_accession>AE004854</Hit_accession>
<Hit_len>11884</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>38.1576</Hsp_bit-score>
<Hsp_score>19</Hsp_score>
<Hsp_evalue>1.0598</Hsp_evalue>
<Hsp_query-from>68</Hsp_query-from>
<Hsp_query-to>86</Hsp_query-to>
<Hsp_hit-from>6012</Hsp_hit-from>
<Hsp_hit-to>6030</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>19</Hsp_identity>
<Hsp_positive>19</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>19</Hsp_align-len>
<Hsp_qseq>CAGGCCAGCGACTTCTGGG</Hsp_qseq>
<Hsp_hseq>CAGGCCAGCGACTTCTGGG</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>2</Hit_num>
<Hit_id>gi|15073988|emb|AL591786.1|SME591786</Hit_id>
<Hit_def>Sinorhizobium meliloti 1021 complete chromosome; segment 5/12</Hit_def>
<Hit_accession>AL591786</Hit_accession>
<Hit_len>299350</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>36.1753</Hsp_bit-score>
<Hsp_score>18</Hsp_score>
<Hsp_evalue>4.18768</Hsp_evalue>
<Hsp_query-from>204</Hsp_query-from>
<Hsp_query-to>224</Hsp_query-to>
<Hsp_hit-from>83648</Hsp_hit-from>
<Hsp_hit-to>83628</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>20</Hsp_identity>
<Hsp_positive>20</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>21</Hsp_align-len>
<Hsp_qseq>TGAAAGGAAATNAAAATGGAA</Hsp_qseq>
<Hsp_hseq>TGAAAGGAAATCAAAATGGAA</Hsp_hseq>
<Hsp_midline>||||||||||| |||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
</Iteration_hits>
<Iteration_stat>
<Statistics>
<Statistics_db-num>371021</Statistics_db-num>
<Statistics_db-len>1233631384</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>0</Statistics_eff-space>
<Statistics_kappa>0.710603</Statistics_kappa>
<Statistics_lambda>1.37406</Statistics_lambda>
<Statistics_entropy>1.30725</Statistics_entropy>
</Statistics>
</Iteration_stat>
</Iteration>
</BlastOutput_iterations>
</BlastOutput>
|