1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268
|
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
"""Dealing with storage of biopython objects in a BioSQL relational db."""
import configparser
import os
import platform
import tempfile
import time
import unittest
from io import StringIO
# Hide annoying warnings from things like bonds in GenBank features,
# or PostgreSQL schema rules. TODO - test these warnings are raised!
import warnings
from Bio import BiopythonWarning
# local stuff
from Bio import MissingExternalDependencyError
from Bio.Seq import Seq, MutableSeq
from Bio.SeqFeature import SeqFeature, UnknownPosition, ExactPosition
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
from BioSQL import BioSeqDatabase
from BioSQL import BioSeq
from seq_tests_common import compare_record, compare_records
if __name__ == "__main__":
raise RuntimeError("Call this via test_BioSQL_*.py not directly")
# Exporting these to the test_BioSQL_XXX.py files which import this file:
# DBDRIVER, DBTYPE, DBHOST, DBUSER, DBPASSWD, TESTDB, DBSCHEMA, SQL_FILE, SYSTEM
SYSTEM = platform.system()
def load_biosql_ini(DBTYPE):
"""Load the database settings from INI file."""
if not os.path.isfile("biosql.ini"):
raise MissingExternalDependencyError(
"BioSQL test configuration file biosql.ini missing (see biosql.ini.sample)"
)
config = configparser.ConfigParser()
config.read("biosql.ini")
DBHOST = config.get(DBTYPE, "dbhost")
DBUSER = config.get(DBTYPE, "dbuser")
DBPASSWD = config.get(DBTYPE, "dbpasswd")
TESTDB = config.get(DBTYPE, "testdb")
return DBHOST, DBUSER, DBPASSWD, TESTDB
def temp_db_filename():
"""Generate a temporary filename for SQLite database."""
# In memory SQLite does not work with current test structure since the tests
# expect databases to be retained between individual tests.
# TESTDB = ':memory:'
# Instead, we use (if we can) /dev/shm
try:
h, test_db_fname = tempfile.mkstemp("_BioSQL.db", dir="/dev/shm")
except OSError:
# We can't use /dev/shm
h, test_db_fname = tempfile.mkstemp("_BioSQL.db")
os.close(h)
return test_db_fname
def check_config(dbdriver, dbtype, dbhost, dbuser, dbpasswd, testdb):
"""Verify the database settings work for connecting."""
global DBDRIVER, DBTYPE, DBHOST, DBUSER, DBPASSWD, TESTDB, DBSCHEMA
global SYSTEM, SQL_FILE
DBDRIVER = dbdriver
DBTYPE = dbtype
DBHOST = dbhost
DBUSER = dbuser
DBPASSWD = dbpasswd
TESTDB = testdb
if not DBDRIVER or not DBTYPE or not DBUSER:
# No point going any further...
raise MissingExternalDependencyError("Incomplete BioSQL test settings")
# Check the database driver is installed:
if SYSTEM == "Java":
try:
if DBDRIVER in ["MySQLdb"]:
import com.mysql.jdbc.Driver
elif DBDRIVER in ["psycopg2", "pgdb"]:
import org.postgresql.Driver
except ImportError:
message = "Install the JDBC driver for %s to use BioSQL " % DBTYPE
raise MissingExternalDependencyError(message) from None
else:
try:
__import__(DBDRIVER)
except ImportError:
if DBDRIVER in ["MySQLdb"]:
message = (
"Install MySQLdb or mysqlclient if you want to use %s with BioSQL "
% (DBTYPE)
)
else:
message = "Install %s if you want to use %s with BioSQL " % (
DBDRIVER,
DBTYPE,
)
raise MissingExternalDependencyError(message) from None
try:
if DBDRIVER in ["sqlite3"]:
server = BioSeqDatabase.open_database(driver=DBDRIVER, db=TESTDB)
else:
server = BioSeqDatabase.open_database(
driver=DBDRIVER, host=DBHOST, user=DBUSER, passwd=DBPASSWD
)
server.close()
del server
except Exception as e:
message = "Connection failed, check settings if you plan to use BioSQL: %s" % e
raise MissingExternalDependencyError(message) from None
DBSCHEMA = "biosqldb-" + DBTYPE + ".sql"
SQL_FILE = os.path.join(os.getcwd(), "BioSQL", DBSCHEMA)
if not os.path.isfile(SQL_FILE):
message = "Missing SQL schema file: %s" % SQL_FILE
raise MissingExternalDependencyError(message)
def _do_db_cleanup():
"""Cleanup everything from TESTDB.
Relevant for MySQL and PostgreSQL.
"""
if DBDRIVER in ["psycopg2", "pgdb"]:
# first open a connection the database
# notice that postgres doesn't have createdb privileges, so
# the TESTDB must exist
server = BioSeqDatabase.open_database(
driver=DBDRIVER, host=DBHOST, user=DBUSER, passwd=DBPASSWD, db=TESTDB
)
# The pgdb postgres driver does not support autocommit, so here we
# commit the current transaction so that 'drop database' query will
# be outside a transaction block
server.adaptor.cursor.execute("COMMIT")
# drop anything in the database
# with Postgres, can get errors about database still being used.
# Wait briefly to be sure previous tests are done with it.
time.sleep(1)
# drop anything in the database
sql = r"DROP OWNED BY " + DBUSER
server.adaptor.cursor.execute(sql, ())
server.close()
else:
# first open a connection to create the database
server = BioSeqDatabase.open_database(
driver=DBDRIVER, host=DBHOST, user=DBUSER, passwd=DBPASSWD
)
# Auto-commit
try:
server.adaptor.autocommit()
except AttributeError:
pass
# drop the database
try:
sql = r"DROP DATABASE " + TESTDB
server.adaptor.cursor.execute(sql, ())
except (
server.module.OperationalError,
server.module.Error,
server.module.DatabaseError,
) as e: # the database doesn't exist
pass
except (
server.module.IntegrityError,
server.module.ProgrammingError,
) as e: # ditto--perhaps
if str(e).find('database "%s" does not exist' % TESTDB) == -1:
server.close()
raise
# create a new database
sql = r"CREATE DATABASE " + TESTDB
server.adaptor.execute(sql, ())
server.close()
def create_database():
"""Delete any existing BioSQL test DB, then (re)create an empty BioSQL DB.
Returns TESTDB name which will change for for SQLite.
"""
if DBDRIVER in ["sqlite3"]:
global TESTDB
if os.path.exists(TESTDB):
try:
os.remove(TESTDB)
except Exception:
time.sleep(1)
try:
os.remove(TESTDB)
except Exception:
# Seen this with PyPy 2.1 (and older) on Windows -
# which suggests an open handle still exists?
print("Could not remove %r" % TESTDB)
pass
# Now pick a new filename - just in case there is a stale handle
# (which might be happening under Windows...)
TESTDB = temp_db_filename()
else:
_do_db_cleanup()
# now open a connection to load the database
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
try:
server.load_database_sql(SQL_FILE)
server.commit()
server.close()
except Exception:
# Failed, but must close the handle...
server.close()
raise
return TESTDB
def destroy_database():
"""Delete any temporary BioSQL sqlite3 database files."""
if DBDRIVER in ["sqlite3"]:
if os.path.exists(TESTDB):
os.remove(TESTDB)
def load_database(gb_filename_or_handle):
"""Load a GenBank file into a new BioSQL database.
This is useful for running tests against a newly created database.
"""
TESTDB = create_database()
# now open a connection to load the database
db_name = "biosql-test"
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
db = server.new_database(db_name)
# get the GenBank file we are going to put into it
iterator = SeqIO.parse(gb_filename_or_handle, "gb")
records = []
for record in iterator:
if record.annotations.get("molecule_type") == "mRNA":
record.annotations["molecule_type"] = "DNA"
records.append(record)
# finally put it in the database
count = db.load(records)
server.commit()
server.close()
return count
def load_multi_database(gb_filename_or_handle, gb_filename_or_handle2):
"""Load two GenBank files into a new BioSQL database as different subdatabases.
This is useful for running tests against a newly created database.
"""
TESTDB = create_database()
# now open a connection to load the database
db_name = "biosql-test"
db_name2 = "biosql-test2"
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
db = server.new_database(db_name)
# get the GenBank file we are going to put into it
iterator = SeqIO.parse(gb_filename_or_handle, "gb")
count = db.load(iterator)
db = server.new_database(db_name2)
# get the GenBank file we are going to put into it
iterator = SeqIO.parse(gb_filename_or_handle2, "gb")
# finally put it in the database
count2 = db.load(iterator)
server.commit()
server.close()
return count + count2
class MultiReadTest(unittest.TestCase):
"""Test reading a database with multiple namespaces."""
loaded_db = 0
def setUp(self):
"""Connect to and load up the database."""
load_multi_database("GenBank/cor6_6.gb", "GenBank/NC_000932.gb")
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.db = self.server["biosql-test"]
self.db2 = self.server["biosql-test2"]
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.db2
del self.server
def test_server(self):
"""Check BioSeqDatabase methods."""
server = self.server
self.assertIn("biosql-test", server)
self.assertIn("biosql-test2", server)
self.assertEqual(2, len(server))
self.assertEqual(["biosql-test", "biosql-test2"], list(server.keys()))
# Check we can delete the namespace...
del server["biosql-test"]
del server["biosql-test2"]
self.assertEqual(0, len(server))
with self.assertRaises(KeyError):
del server["non-existant-name"]
def test_get_db_items(self):
"""Check list, keys, length etc."""
db = self.db
items = list(db.values())
keys = list(db)
length = len(items)
self.assertEqual(length, len(db))
self.assertEqual(length, len(list(db)))
self.assertEqual(length, len(list(db.items())))
self.assertEqual(length, len(list(db.keys())))
self.assertEqual(length, len(list(db.values())))
for (k1, r1), (k2, r2) in zip(zip(keys, items), db.items()):
self.assertEqual(k1, k2)
self.assertEqual(r1.id, r2.id)
for k in keys:
del db[k]
self.assertEqual(0, len(db))
with self.assertRaises(KeyError):
del db["non-existant-name"]
def test_cross_retrieval_of_items(self):
"""Test that valid ids can't be retrieved between namespaces."""
db = self.db
db2 = self.db2
for db2_id in db2.keys():
with self.assertRaises(KeyError):
rec = db[db2_id]
class ReadTest(unittest.TestCase):
"""Test reading a database from an already built database."""
loaded_db = 0
def setUp(self):
"""Connect to and load up the database."""
load_database("GenBank/cor6_6.gb")
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.db = self.server["biosql-test"]
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.server
def test_server(self):
"""Check BioSeqDatabase methods."""
server = self.server
self.assertIn("biosql-test", server)
self.assertEqual(1, len(server))
self.assertEqual(["biosql-test"], list(server.keys()))
# Check we can delete the namespace...
del server["biosql-test"]
self.assertEqual(0, len(server))
with self.assertRaises(KeyError):
del server["non-existant-name"]
def test_get_db_items(self):
"""Check list, keys, length etc."""
db = self.db
items = list(db.values())
keys = list(db)
length = len(items)
self.assertEqual(length, len(db))
self.assertEqual(length, len(list(db.items())))
self.assertEqual(length, len(list(db)))
self.assertEqual(length, len(list(db.values())))
for (k1, r1), (k2, r2) in zip(zip(keys, items), db.items()):
self.assertEqual(k1, k2)
self.assertEqual(r1.id, r2.id)
for k in keys:
del db[k]
self.assertEqual(0, len(db))
with self.assertRaises(KeyError):
del db["non-existant-name"]
def test_lookup_items(self):
"""Test retrieval of items using various ids."""
self.db.lookup(accession="X62281")
try:
self.db.lookup(accession="Not real")
raise AssertionError("No problem on fake id retrieval")
except IndexError:
pass
self.db.lookup(display_id="ATKIN2")
try:
self.db.lookup(display_id="Not real")
raise AssertionError("No problem on fake id retrieval")
except IndexError:
pass
# primary id retrieval
self.db.lookup(primary_id="16353")
try:
self.db.lookup(primary_id="Not Real")
raise AssertionError("No problem on fake primary id retrieval")
except IndexError:
pass
class SeqInterfaceTest(unittest.TestCase):
"""Make sure the BioSQL objects implement the expected biopython interface."""
def setUp(self):
"""Load a database."""
load_database("GenBank/cor6_6.gb")
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.db = self.server["biosql-test"]
self.item = self.db.lookup(accession="X62281")
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.item
del self.server
def test_seq_record(self):
"""Make sure SeqRecords from BioSQL implement the right interface."""
test_record = self.item
self.assertIsInstance(test_record.seq, BioSeq.DBSeq)
self.assertEqual(test_record.id, "X62281.1", test_record.id)
self.assertEqual(test_record.name, "ATKIN2")
self.assertEqual(test_record.description, "A.thaliana kin2 gene")
self.assertTrue(hasattr(test_record, "annotations"))
# XXX should do something with annotations once they are like
# a dictionary
for feature in test_record.features:
self.assertIsInstance(feature, SeqFeature)
# shouldn't cause any errors!
self.assertIsInstance(str(test_record), str)
# Confirm can delete annotations etc to test these properties
del test_record.annotations
del test_record.dbxrefs
del test_record.features
del test_record.seq
def test_seq(self):
"""Make sure Seqs from BioSQL implement the right interface."""
test_seq = self.item.seq
data = test_seq.data
self.assertEqual(type(data), type(""))
string_rep = str(test_seq)
self.assertEqual(string_rep, str(test_seq)) # check __str__ too
self.assertEqual(type(string_rep), type(""))
self.assertEqual(len(test_seq), 880)
self.assertEqual(test_seq[879], "A")
self.assertEqual(test_seq[-1], "A")
self.assertEqual(test_seq[0], "A")
self.assertEqual(test_seq[-880], "A")
self.assertRaises(IndexError, test_seq.__getitem__, 880)
self.assertRaises(IndexError, test_seq.__getitem__, -881)
self.assertRaises(TypeError, test_seq.__getitem__, None)
def test_convert(self):
"""Check can turn a DBSeq object into a Seq or MutableSeq."""
test_seq = self.item.seq
other = test_seq.toseq()
self.assertEqual(str(test_seq), str(other))
self.assertIsInstance(other, Seq)
other = test_seq.tomutable()
self.assertEqual(str(test_seq), str(other))
self.assertIsInstance(other, MutableSeq)
def test_addition(self):
"""Check can add DBSeq objects together."""
test_seq = self.item.seq
for other in [
Seq("ACGT"),
MutableSeq("ACGT"),
"ACGT",
test_seq,
]:
test = test_seq + other
self.assertEqual(str(test), str(test_seq) + str(other))
self.assertIsInstance(test, Seq)
test = other + test_seq
self.assertEqual(str(test), str(other) + str(test_seq))
def test_multiplication(self):
"""Check can multiply DBSeq objects by integers."""
test_seq = self.item.seq
tripled = test_seq * 3
# Test DBSeq.__mul__
self.assertIsInstance(tripled, Seq)
self.assertNotIsInstance(tripled, BioSeq.DBSeq)
self.assertEqual(tripled, str(test_seq) * 3)
# Test DBSeq.__rmul__
tripled = 3 * test_seq
self.assertIsInstance(tripled, Seq)
self.assertNotIsInstance(tripled, BioSeq.DBSeq)
self.assertEqual(tripled, str(test_seq) * 3)
# Test DBSeq.__imul__
original = self.item.seq
tripled = test_seq
tripled *= 3
self.assertIsInstance(tripled, Seq)
self.assertNotIsInstance(tripled, BioSeq.DBSeq)
self.assertEqual(tripled, str(original) * 3)
def test_seq_slicing(self):
"""Check that slices of sequences are retrieved properly."""
test_seq = self.item.seq
new_seq = test_seq[:10]
self.assertIsInstance(new_seq, BioSeq.DBSeq)
# simple slicing
self.assertEqual(str(test_seq[:5]), "ATTTG")
self.assertEqual(str(test_seq[0:5]), "ATTTG")
self.assertEqual(str(test_seq[2:3]), "T")
self.assertEqual(str(test_seq[2:4]), "TT")
self.assertEqual(str(test_seq[870:]), "TTGAATTATA")
# getting more fancy
self.assertEqual(test_seq[-1], "A")
self.assertEqual(test_seq[1], "T")
self.assertEqual(str(test_seq[-10:][5:]), "TTATA")
self.assertEqual(str(test_seq[-10:][5:]), "TTATA")
def test_record_slicing(self):
"""Check that slices of DBSeqRecord are retrieved properly."""
new_rec = self.item[400:]
self.assertIsInstance(new_rec, SeqRecord)
self.assertEqual(len(new_rec), 480)
self.assertEqual(len(new_rec.features), 5)
def test_seq_features(self):
"""Check SeqFeatures of a sequence."""
test_features = self.item.features
cds_feature = test_features[6]
self.assertEqual(cds_feature.type, "CDS")
self.assertEqual(
str(cds_feature.location), "join{[103:160](+), [319:390](+), [503:579](+)}"
)
try:
self.assertEqual(cds_feature.qualifiers["gene"], ["kin2"])
self.assertEqual(cds_feature.qualifiers["protein_id"], ["CAA44171.1"])
self.assertEqual(cds_feature.qualifiers["codon_start"], ["1"])
except KeyError:
raise KeyError(
"Missing expected entries, have %r" % cds_feature.qualifiers
) from None
self.assertIn("db_xref", cds_feature.qualifiers)
multi_ann = cds_feature.qualifiers["db_xref"]
self.assertEqual(len(multi_ann), 2)
self.assertIn("GI:16354", multi_ann)
self.assertIn("SWISS-PROT:P31169", multi_ann)
class LoaderTest(unittest.TestCase):
"""Load a database from a GenBank file."""
def setUp(self):
# create TESTDB
TESTDB = create_database()
# load the database
db_name = "biosql-test"
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
# remove the database if it already exists
try:
self.server[db_name]
self.server.remove_database(db_name)
except KeyError:
pass
self.db = self.server.new_database(db_name)
# get the GenBank file we are going to put into it
self.iterator = SeqIO.parse("GenBank/cor6_6.gb", "gb")
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.server
def test_load_database(self):
"""Load SeqRecord objects into a BioSQL database."""
self.db.load(self.iterator)
# do some simple tests to make sure we actually loaded the right
# thing. More advanced tests in a different module.
items = list(self.db.values())
self.assertEqual(len(items), 6)
self.assertEqual(len(self.db), 6)
item_names = []
item_ids = []
for item in items:
item_names.append(item.name)
item_ids.append(item.id)
item_names.sort()
item_ids.sort()
self.assertEqual(
item_names,
["AF297471", "ARU237582", "ATCOR66M", "ATKIN2", "BNAKINI", "BRRBIF72"],
)
self.assertEqual(
item_ids,
[
"AF297471.1",
"AJ237582.1",
"L31939.1",
"M81224.1",
"X55053.1",
"X62281.1",
],
)
class DeleteTest(unittest.TestCase):
"""Test proper deletion of entries from a database."""
loaded_db = 0
def setUp(self):
"""Connect to and load up the database."""
load_database("GenBank/cor6_6.gb")
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.db = self.server["biosql-test"]
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.server
def test_server(self):
"""Check BioSeqDatabase methods."""
server = self.server
self.assertIn("biosql-test", server)
self.assertEqual(1, len(server))
self.assertEqual(["biosql-test"], list(server.keys()))
# Check we can delete the namespace...
del server["biosql-test"]
self.assertEqual(0, len(server))
with self.assertRaises(KeyError):
del server["non-existant-name"]
def test_del_db_items(self):
"""Check all associated data is deleted from an item."""
db = self.db
items = list(db.values())
keys = list(db)
length = len(items)
for seq_id in keys:
sql = "SELECT seqfeature_id from seqfeature where bioentry_id = '%s'"
# get the original number of seqfeatures associated with the bioentry
seqfeatures = self.db.adaptor.execute_and_fetchall(sql % (seq_id))
del db[seq_id]
# check to see that the entry in the bioentry table is removed
self.assertEqual(seq_id in db, False)
# no need to check seqfeature presence if it had none to begin with
if len(seqfeatures):
rows_d = self.db.adaptor.execute_and_fetchall(sql % (seq_id))
# check to see that associated data is removed
self.assertEqual(len(rows_d), 0)
self.assertEqual(0, len(list(db.values())))
class DupLoadTest(unittest.TestCase):
"""Check a few duplicate conditions fail."""
def setUp(self):
# drop any old database and create a new one:
TESTDB = create_database()
# connect to new database:
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
# Create new namespace within new empty database:
self.db = self.server.new_database("biosql-test")
def tearDown(self):
self.server.rollback()
self.server.close()
destroy_database()
del self.db
del self.server
def test_duplicate_load(self):
"""Make sure can't import a single record twice (in one go)."""
record = SeqRecord(
Seq("ATGCTATGACTAT"), id="Test1", annotations={"molecule_type": "DNA"}
)
try:
count = self.db.load([record, record])
except Exception as err:
# Good!
# Note we don't do a specific exception handler because the
# exception class will depend on which DB back end is in use.
self.assertTrue(
err.__class__.__name__
in [
"IntegrityError",
"UniqueViolation",
"AttributeError",
"OperationalError",
],
err.__class__.__name__,
)
return
raise Exception("Should have failed! Loaded %i records" % count)
def test_duplicate_load2(self):
"""Make sure can't import a single record twice (in steps)."""
record = SeqRecord(
Seq("ATGCTATGACTAT"), id="Test2", annotations={"molecule_type": "DNA"}
)
count = self.db.load([record])
self.assertEqual(count, 1)
try:
count = self.db.load([record])
except Exception as err:
# Good!
self.assertTrue(
err.__class__.__name__
in ["IntegrityError", "UniqueViolation", "AttributeError"],
err.__class__.__name__,
)
return
raise Exception("Should have failed! Loaded %i records" % count)
def test_duplicate_id_load(self):
"""Make sure can't import records with same ID (in one go)."""
record1 = SeqRecord(
Seq("ATGCTATGACTAT"), id="TestA", annotations={"molecule_type": "DNA"}
)
record2 = SeqRecord(
Seq("GGGATGCGACTAT"), id="TestA", annotations={"molecule_type": "DNA"}
)
try:
count = self.db.load([record1, record2])
except Exception as err:
# Good!
self.assertTrue(
err.__class__.__name__
in ["IntegrityError", "UniqueViolation", "AttributeError"],
err.__class__.__name__,
)
return
raise Exception("Should have failed! Loaded %i records" % count)
class ClosedLoopTest(unittest.TestCase):
"""Test file -> BioSQL -> file."""
@classmethod
def setUpClass(cls):
# NOTE - For speed I don't bother to create a new database each time,
# simply a new unique namespace is used for each test.
TESTDB = create_database()
def test_NC_005816(self):
"""From GenBank file to BioSQL and back to a GenBank file, NC_005816."""
with warnings.catch_warnings():
# BiopythonWarning: order location operators are not fully supported
warnings.simplefilter("ignore", BiopythonWarning)
self.loop("GenBank/NC_005816.gb", "gb")
def test_NC_000932(self):
"""From GenBank file to BioSQL and back to a GenBank file, NC_000932."""
self.loop("GenBank/NC_000932.gb", "gb")
def test_NT_019265(self):
"""From GenBank file to BioSQL and back to a GenBank file, NT_019265."""
self.loop("GenBank/NT_019265.gb", "gb")
def test_protein_refseq2(self):
"""From GenBank file to BioSQL and back to a GenBank file, protein_refseq2."""
with warnings.catch_warnings():
# BiopythonWarning: order location operators are not fully supported
warnings.simplefilter("ignore", BiopythonWarning)
self.loop("GenBank/protein_refseq2.gb", "gb")
def test_no_ref(self):
"""From GenBank file to BioSQL and back to a GenBank file, noref."""
self.loop("GenBank/noref.gb", "gb")
def test_one_of(self):
"""From GenBank file to BioSQL and back to a GenBank file, one_of."""
self.loop("GenBank/one_of.gb", "gb")
def test_cor6_6(self):
"""From GenBank file to BioSQL and back to a GenBank file, cor6_6."""
self.loop("GenBank/cor6_6.gb", "gb")
def test_arab1(self):
"""From GenBank file to BioSQL and back to a GenBank file, arab1."""
self.loop("GenBank/arab1.gb", "gb")
def loop(self, filename, format):
original_records = []
for record in SeqIO.parse(filename, format):
if "RNA" in record.annotations.get("molecule_type", ""):
if "U" in record.seq:
record.annotations["molecule_type"] = "RNA"
else:
record.annotations["molecule_type"] = "DNA"
original_records.append(record)
# now open a connection to load the database
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
db_name = "test_loop_%s" % filename # new namespace!
db = server.new_database(db_name)
count = db.load(original_records)
self.assertEqual(count, len(original_records))
server.commit()
# Now read them back...
biosql_records = [db.lookup(name=rec.name) for rec in original_records]
# And check they agree
self.assertTrue(compare_records(original_records, biosql_records))
# Now write to a handle...
handle = StringIO()
SeqIO.write(biosql_records, handle, "gb")
# Now read them back...
handle.seek(0)
new_records = list(SeqIO.parse(handle, "gb"))
# And check they still agree
self.assertEqual(len(new_records), len(original_records))
for old, new in zip(original_records, new_records):
# TODO - remove this hack because we don't yet write these (yet):
for key in ["comment", "references", "db_source"]:
if key in old.annotations and key not in new.annotations:
del old.annotations[key]
self.assertTrue(compare_record(old, new))
# Done
handle.close()
server.close()
class TransferTest(unittest.TestCase):
"""Test file -> BioSQL, BioSQL -> BioSQL."""
# NOTE - For speed I don't bother to create a new database each time,
# simply a new unique namespace is used for each test.
def setUp(self):
TESTDB = create_database()
def test_NC_005816(self):
"""From GenBank file to BioSQL, then again to a new namespace, NC_005816."""
with warnings.catch_warnings():
# BiopythonWarning: order location operators are not fully supported
warnings.simplefilter("ignore", BiopythonWarning)
self.trans("GenBank/NC_005816.gb", "gb")
def test_NC_000932(self):
"""From GenBank file to BioSQL, then again to a new namespace, NC_000932."""
self.trans("GenBank/NC_000932.gb", "gb")
def test_NT_019265(self):
"""From GenBank file to BioSQL, then again to a new namespace, NT_019265."""
self.trans("GenBank/NT_019265.gb", "gb")
def test_protein_refseq2(self):
"""From GenBank file to BioSQL, then again to a new namespace, protein_refseq2."""
with warnings.catch_warnings():
# BiopythonWarning: order location operators are not fully supported
warnings.simplefilter("ignore", BiopythonWarning)
self.trans("GenBank/protein_refseq2.gb", "gb")
def test_no_ref(self):
"""From GenBank file to BioSQL, then again to a new namespace, noref."""
self.trans("GenBank/noref.gb", "gb")
def test_one_of(self):
"""From GenBank file to BioSQL, then again to a new namespace, one_of."""
self.trans("GenBank/one_of.gb", "gb")
def test_cor6_6(self):
"""From GenBank file to BioSQL, then again to a new namespace, cor6_6."""
self.trans("GenBank/cor6_6.gb", "gb")
def test_arab1(self):
"""From GenBank file to BioSQL, then again to a new namespace, arab1."""
self.trans("GenBank/arab1.gb", "gb")
def trans(self, filename, format):
original_records = []
for record in SeqIO.parse(filename, format):
if record.annotations.get("molecule_type") == "mRNA":
record.annotations["molecule_type"] = "DNA"
original_records.append(record)
# now open a connection to load the database
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
db_name = "test_trans1_%s" % filename # new namespace!
db = server.new_database(db_name)
count = db.load(original_records)
self.assertEqual(count, len(original_records))
server.commit()
# Now read them back...
biosql_records = [db.lookup(name=rec.name) for rec in original_records]
# And check they agree
self.assertTrue(compare_records(original_records, biosql_records))
# Now write to a second name space...
db_name = "test_trans2_%s" % filename # new namespace!
db = server.new_database(db_name)
count = db.load(biosql_records)
self.assertEqual(count, len(original_records))
# Now read them back again,
biosql_records2 = [db.lookup(name=rec.name) for rec in original_records]
# And check they also agree
self.assertTrue(compare_records(original_records, biosql_records2))
# Done
server.close()
def tearDown(self):
destroy_database()
class InDepthLoadTest(unittest.TestCase):
"""Make sure we are loading and retreiving in a semi-lossless fashion."""
def setUp(self):
gb_file = os.path.join(os.getcwd(), "GenBank", "cor6_6.gb")
load_database(gb_file)
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.db = self.server["biosql-test"]
def tearDown(self):
self.server.close()
destroy_database()
del self.db
del self.server
def test_transfer(self):
"""Make sure can load record into another namespace."""
# Should be in database already...
db_record = self.db.lookup(accession="X55053")
# Make a new namespace
db2 = self.server.new_database("biosql-test-alt")
# Should be able to load this DBSeqRecord there...
count = db2.load([db_record])
self.assertEqual(count, 1)
def test_reload(self):
"""Make sure can't reimport existing records."""
gb_file = os.path.join(os.getcwd(), "GenBank", "cor6_6.gb")
with open(gb_file) as gb_handle:
record = next(SeqIO.parse(gb_handle, "gb"))
# Should be in database already...
db_record = self.db.lookup(accession="X55053")
self.assertEqual(db_record.id, record.id)
self.assertEqual(db_record.name, record.name)
self.assertEqual(db_record.description, record.description)
self.assertEqual(str(db_record.seq), str(record.seq))
# Good... now try reloading it!
try:
count = self.db.load([record])
except Exception as err:
# Good!
self.assertTrue(
err.__class__.__name__
in ["IntegrityError", "UniqueViolation", "AttributeError"],
err.__class__.__name__,
)
return
raise Exception("Should have failed! Loaded %i records" % count)
def test_record_loading(self):
"""Make sure all records are correctly loaded."""
test_record = self.db.lookup(accession="X55053")
self.assertEqual(test_record.name, "ATCOR66M")
self.assertEqual(test_record.id, "X55053.1")
self.assertEqual(test_record.description, "A.thaliana cor6.6 mRNA")
self.assertEqual(test_record.annotations["molecule_type"], "DNA")
self.assertEqual(test_record.seq[:20], "AACAAAACACACATCAAAAA")
test_record = self.db.lookup(accession="X62281")
self.assertEqual(test_record.name, "ATKIN2")
self.assertEqual(test_record.id, "X62281.1")
self.assertEqual(test_record.description, "A.thaliana kin2 gene")
self.assertEqual(test_record.annotations["molecule_type"], "DNA")
self.assertEqual(test_record.seq[:10], "ATTTGGCCTA")
def test_seq_feature(self):
"""In depth check that SeqFeatures are transmitted through the db."""
test_record = self.db.lookup(accession="AJ237582")
features = test_record.features
self.assertEqual(len(features), 7)
# test single locations
test_feature = features[0]
self.assertEqual(test_feature.type, "source")
self.assertEqual(str(test_feature.location), "[0:206](+)")
self.assertEqual(len(test_feature.qualifiers), 3)
self.assertEqual(test_feature.qualifiers["country"], ["Russia:Bashkortostan"])
self.assertEqual(test_feature.qualifiers["organism"], ["Armoracia rusticana"])
self.assertEqual(test_feature.qualifiers["db_xref"], ["taxon:3704"])
# test split locations
test_feature = features[4]
self.assertEqual(test_feature.type, "CDS")
self.assertEqual(str(test_feature.location), "join{[0:48](+), [142:206](+)}")
self.assertEqual(len(test_feature.location.parts), 2)
self.assertEqual(str(test_feature.location.parts[0]), "[0:48](+)")
self.assertEqual(str(test_feature.location.parts[1]), "[142:206](+)")
self.assertEqual(test_feature.location.operator, "join")
self.assertEqual(len(test_feature.qualifiers), 6)
self.assertEqual(test_feature.qualifiers["gene"], ["csp14"])
self.assertEqual(test_feature.qualifiers["codon_start"], ["2"])
self.assertEqual(test_feature.qualifiers["product"], ["cold shock protein"])
self.assertEqual(test_feature.qualifiers["protein_id"], ["CAB39890.1"])
self.assertEqual(test_feature.qualifiers["db_xref"], ["GI:4538893"])
self.assertEqual(
test_feature.qualifiers["translation"],
["DKAKDAAAAAGASAQQAGKNISDAAAGGVNFVKEKTG"],
)
# test passing strand information
# XXX We should be testing complement as well
test_record = self.db.lookup(accession="AJ237582")
test_feature = test_record.features[4] # DNA, no complement
self.assertEqual(test_feature.strand, 1)
for loc in test_feature.location.parts:
self.assertEqual(loc.strand, 1)
test_record = self.db.lookup(accession="X55053")
test_feature = test_record.features[0]
# mRNA, so really cDNA, so the strand should be 1 (not complemented)
self.assertEqual(test_feature.strand, 1)
#####################################################################
class AutoSeqIOTests(unittest.TestCase):
"""Test SeqIO and BioSQL together."""
server = None
db = None
@classmethod
def setUpClass(cls):
# Create and reuse on database for all tests in this class
TESTDB = create_database()
def setUp(self):
"""Connect to the database."""
db_name = "biosql-test-seqio"
server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
self.server = server
if db_name not in server:
self.db = server.new_database(db_name)
server.commit()
self.db = self.server[db_name]
def tearDown(self):
if self.db:
del self.db
if self.server:
self.server.close()
del self.server
def check(self, t_format, t_filename, t_count=1):
db = self.db
records = []
for record in SeqIO.parse(t_filename, t_format):
molecule_type = record.annotations.get("molecule_type")
if molecule_type is not None:
if "DNA" in molecule_type:
record.annotations["molecule_type"] = "DNA"
elif "RNA" in molecule_type:
record.annotations["molecule_type"] = "RNA"
elif "protein" in molecule_type:
record.annotations["molecule_type"] = "protein"
else:
raise Exception("Unknown molecule type '%s'" % molecule_type)
records.append(record)
count = db.load(records)
assert count == t_count
self.server.commit()
for record in records:
# print(" - %s, %s" % (checksum_summary(record), record.id))
key = record.name
# print(" - Retrieving by name/display_id '%s'," % key)
db_rec = db.lookup(name=key)
compare_record(record, db_rec)
db_rec = db.lookup(display_id=key)
compare_record(record, db_rec)
key = record.id
if key.count(".") == 1 and key.split(".")[1].isdigit():
# print(" - Retrieving by version '%s'," % key)
db_rec = db.lookup(version=key)
compare_record(record, db_rec)
if "accessions" in record.annotations:
# Only expect FIRST accession to work!
key = record.annotations["accessions"][0]
assert key, "Blank accession in annotation %r" % record.annotations
if key != record.id:
# print(" - Retrieving by accession '%s'," % key)
db_rec = db.lookup(accession=key)
compare_record(record, db_rec)
if "gi" in record.annotations:
key = record.annotations["gi"]
if key != record.id:
# print(" - Retrieving by GI '%s'," % key)
db_rec = db.lookup(primary_id=key)
compare_record(record, db_rec)
def test_SeqIO_loading(self):
self.check("fasta", "Fasta/lupine.nu")
self.check("fasta", "Fasta/elderberry.nu")
self.check("fasta", "Fasta/phlox.nu")
self.check("fasta", "Fasta/centaurea.nu")
self.check("fasta", "Fasta/wisteria.nu")
self.check("fasta", "Fasta/sweetpea.nu")
self.check("fasta", "Fasta/lavender.nu")
self.check("fasta", "Fasta/aster.pro")
self.check("fasta", "Fasta/loveliesbleeding.pro")
self.check("fasta", "Fasta/rose.pro")
self.check("fasta", "Fasta/rosemary.pro")
self.check("fasta", "Fasta/f001")
self.check("fasta", "Fasta/f002", 3)
self.check("fasta", "Fasta/fa01", 2)
self.check("fasta", "GFF/NC_001802.fna")
self.check("fasta", "GFF/multi.fna", 3)
self.check("fasta", "Registry/seqs.fasta", 2)
self.check("swiss", "SwissProt/sp001")
self.check("swiss", "SwissProt/sp002")
self.check("swiss", "SwissProt/sp003")
self.check("swiss", "SwissProt/P0A186.txt")
self.check("swiss", "SwissProt/sp005")
self.check("swiss", "SwissProt/sp006")
self.check("swiss", "SwissProt/sp007")
self.check("swiss", "SwissProt/sp008")
self.check("swiss", "SwissProt/sp009")
self.check("swiss", "SwissProt/sp010")
self.check("swiss", "SwissProt/sp011")
self.check("swiss", "SwissProt/sp012")
self.check("swiss", "SwissProt/sp013")
self.check("swiss", "SwissProt/P60137.txt")
self.check("swiss", "SwissProt/sp015")
self.check("swiss", "SwissProt/sp016")
self.check("swiss", "Registry/EDD_RAT.dat")
self.check("genbank", "GenBank/noref.gb")
self.check("genbank", "GenBank/cor6_6.gb", 6)
self.check("genbank", "GenBank/iro.gb")
self.check("genbank", "GenBank/pri1.gb")
self.check("genbank", "GenBank/arab1.gb")
with warnings.catch_warnings():
# BiopythonWarning: order location operators are not fully
# supported
warnings.simplefilter("ignore", BiopythonWarning)
self.check("genbank", "GenBank/protein_refseq2.gb")
self.check("genbank", "GenBank/extra_keywords.gb")
self.check("genbank", "GenBank/one_of.gb")
self.check("genbank", "GenBank/NT_019265.gb")
self.check("genbank", "GenBank/origin_line.gb")
self.check("genbank", "GenBank/blank_seq.gb")
with warnings.catch_warnings():
# BiopythonWarning: bond location operators are not fully supported
warnings.simplefilter("ignore", BiopythonWarning)
self.check("genbank", "GenBank/dbsource_wrap.gb")
# BiopythonWarning: order location operators are not fully
# supported
self.check("genbank", "GenBank/NC_005816.gb")
self.check("genbank", "GenBank/gbvrl1_start.seq", 3)
self.check("genbank", "GFF/NC_001422.gbk")
self.check("embl", "EMBL/TRBG361.embl")
self.check("embl", "EMBL/DD231055_edited.embl")
self.check("embl", "EMBL/SC10H5.embl")
self.check("embl", "EMBL/U87107.embl")
self.assertEqual(len(self.db), 66)
class SwissProtUnknownPositionTest(unittest.TestCase):
"""Handle SwissProt unknown position by setting value to null in database."""
def setUp(self):
# drop any old database and create a new one:
TESTDB = create_database()
# connect to new database:
self.server = BioSeqDatabase.open_database(
driver=DBDRIVER, user=DBUSER, passwd=DBPASSWD, host=DBHOST, db=TESTDB
)
# Create new namespace within new empty database:
self.db = self.server.new_database("biosql-test")
def tearDown(self):
self.server.rollback()
self.server.close()
destroy_database()
del self.db
del self.server
def test_ambiguous_location(self):
"""Loaded uniprot-xml with ambiguous location in BioSQL."""
id = "P97881"
seqiter = SeqIO.parse("SwissProt/%s.xml" % id, "uniprot-xml")
self.assertEqual(self.db.load(seqiter), 1)
dbrecord = self.db.lookup(primary_id=id)
for feature in dbrecord.features:
if feature.type == "signal peptide":
self.assertIsInstance(feature.location.end, UnknownPosition)
elif feature.type == "chain":
self.assertIsInstance(feature.location.start, UnknownPosition)
else:
self.assertIsInstance(feature.location.start, ExactPosition)
|