1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343
|
# Copyright 2001 by Brad Chapman. All rights reserved.
# Revisions copyright 2011-2013 by Peter Cock. All rights reserved.
# Copyright 2015-2017 by Kai Blin. All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
"""Tests Bio.SeqFeature."""
import unittest
from copy import deepcopy
from os import path
from Bio import Seq
from Bio import SeqIO
from Bio import SeqRecord
from Bio.Data.CodonTable import TranslationError
from Bio.SeqFeature import AfterPosition
from Bio.SeqFeature import BeforePosition
from Bio.SeqFeature import BetweenPosition
from Bio.SeqFeature import CompoundLocation
from Bio.SeqFeature import ExactPosition
from Bio.SeqFeature import SimpleLocation
from Bio.SeqFeature import OneOfPosition
from Bio.SeqFeature import SeqFeature
from Bio.SeqFeature import UnknownPosition
from Bio.SeqFeature import WithinPosition
class TestReference(unittest.TestCase):
"""Tests for the SeqFeature.Reference class."""
def test_eq_identical(self):
"""Test two identical references eq() to True."""
testfile = path.join("GenBank", "origin_line.gb")
rec1 = SeqIO.read(testfile, "genbank")
rec2 = SeqIO.read(testfile, "genbank")
self.assertEqual(
rec1.annotations["references"][0], rec1.annotations["references"][0]
)
self.assertEqual(
rec1.annotations["references"][0], rec2.annotations["references"][0]
)
self.assertNotEqual(
rec1.annotations["references"][0], rec1.annotations["references"][1]
)
self.assertNotEqual(
rec1.annotations["references"][0], rec2.annotations["references"][1]
)
self.assertEqual(
rec1.annotations["references"][1], rec1.annotations["references"][1]
)
self.assertEqual(
rec1.annotations["references"][1], rec2.annotations["references"][1]
)
class TestSimpleLocation(unittest.TestCase):
"""Tests for the SeqFeature.SimpleLocation class."""
def test_offsets(self):
"""Test adding and subtracting integer offsets."""
loc1 = SimpleLocation(23, 42, -1)
loc2 = SimpleLocation(123, 142, -1)
self.assertEqual(loc1 + 100, loc2)
self.assertEqual(loc1, loc2 + (-100))
self.assertEqual(loc1, loc2 - 100)
self.assertEqual(loc1 + 50, loc2 - 50)
with self.assertRaises(TypeError):
loc1 + "Hello"
with self.assertRaises(TypeError):
loc1 - "Hello"
def test_eq_identical(self):
"""Test two identical locations are equal."""
loc1 = SimpleLocation(23, 42, 1)
loc2 = SimpleLocation(23, 42, 1)
self.assertEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, -1)
loc2 = SimpleLocation(23, 42, -1)
self.assertEqual(loc1, loc2)
loc1 = SimpleLocation(BeforePosition(23), AfterPosition(42), 1)
loc2 = SimpleLocation(23, 42, 1)
self.assertEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1, "foo", "bar")
loc2 = SimpleLocation(23, 42, 1, "foo", "bar")
self.assertEqual(loc1, loc2)
def test_eq_not_identical(self):
"""Test two different locations are not equal."""
loc1 = SimpleLocation(22, 42, 1)
loc2 = SimpleLocation(23, 42, 1)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1)
loc2 = SimpleLocation(23, 43, 1)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1)
loc2 = SimpleLocation(23, 42, -1)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1)
loc2 = (23, 42, 1)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1, "foo")
loc2 = SimpleLocation(23, 42, 1, "bar")
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(23, 42, 1, "foo", "bar")
loc2 = SimpleLocation(23, 42, 1, "foo", "baz")
self.assertNotEqual(loc1, loc2)
def test_start_before_end(self):
expected = "must be greater than or equal to start location"
with self.assertRaises(ValueError) as err:
SimpleLocation(42, 23, 1)
self.assertIn(expected, str(err.exception))
with self.assertRaises(ValueError) as err:
SimpleLocation(42, 0, 1)
self.assertIn(expected, str(err.exception))
with self.assertRaises(ValueError) as err:
SimpleLocation(BeforePosition(42), AfterPosition(23), -1)
self.assertIn(expected, str(err.exception))
with self.assertRaises(ValueError) as err:
SimpleLocation(42, AfterPosition(0), 1)
self.assertIn(expected, str(err.exception))
# Features with UnknownPositions should pass check
SimpleLocation(42, UnknownPosition())
SimpleLocation(UnknownPosition(), 42)
# Same start and end should pass check
SimpleLocation(42, 42)
class TestCompoundLocation(unittest.TestCase):
"""Tests for the SeqFeature.CompoundLocation class."""
def test_eq_identical(self):
"""Test two identical locations are equal."""
loc1 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
loc2 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
self.assertEqual(loc1, loc2)
loc1 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
loc2 = CompoundLocation([SimpleLocation(12, 17, 1), SimpleLocation(23, 42, 1)])
self.assertEqual(loc1, loc2)
def test_eq_not_identical(self):
"""Test two different locations are not equal."""
loc1 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
loc2 = (
SimpleLocation(12, 17, 1)
+ SimpleLocation(23, 42, 1)
+ SimpleLocation(50, 60, 1)
)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
loc2 = SimpleLocation(12, 17, -1) + SimpleLocation(23, 42, -1)
self.assertNotEqual(loc1, loc2)
loc1 = CompoundLocation([SimpleLocation(12, 17, 1), SimpleLocation(23, 42, 1)])
loc2 = CompoundLocation(
[SimpleLocation(12, 17, 1), SimpleLocation(23, 42, 1)], "order"
)
self.assertNotEqual(loc1, loc2)
loc1 = SimpleLocation(12, 17, 1) + SimpleLocation(23, 42, 1)
loc2 = 5
self.assertNotEqual(loc1, loc2)
class TestSeqFeature(unittest.TestCase):
"""Tests for the SeqFeature.SeqFeature class."""
def test_eq_identical(self):
f1 = SeqFeature(
type="CDS",
location=SimpleLocation(0, 182, 1),
qualifiers={
"product": ["interferon beta, fibroblast"],
},
)
f2 = deepcopy(f1)
self.assertEqual(f1, f2)
def test_translation_checks_cds(self):
"""Test that a CDS feature is subject to respective checks."""
seq = Seq.Seq("GGTTACACTTACCGATAATGTCTCTGATGA")
f = SeqFeature(SimpleLocation(0, 30), type="CDS")
f.qualifiers["transl_table"] = [11]
with self.assertRaises(TranslationError):
f.translate(seq)
class TestLocations(unittest.TestCase):
def test_fuzzy(self):
"""Test fuzzy representations."""
# check the positions alone
exact_pos = ExactPosition(5)
within_pos_s = WithinPosition(10, left=10, right=13)
within_pos_e = WithinPosition(13, left=10, right=13)
between_pos_e = BetweenPosition(24, left=20, right=24)
before_pos = BeforePosition(15)
after_pos = AfterPosition(40)
self.assertEqual(int(within_pos_s), 10)
self.assertEqual(str(within_pos_s), "(10.13)")
self.assertEqual(int(within_pos_e), 13)
self.assertEqual(str(within_pos_e), "(10.13)")
self.assertEqual(int(between_pos_e), 24)
self.assertEqual(str(between_pos_e), "(20^24)")
self.assertEqual(str(before_pos), "<15")
self.assertEqual(str(after_pos), ">40")
# put these into Locations
location1 = SimpleLocation(exact_pos, within_pos_e)
location2 = SimpleLocation(before_pos, between_pos_e)
location3 = SimpleLocation(within_pos_s, after_pos)
self.assertEqual(str(location1), "[5:(10.13)]")
self.assertEqual(str(location1.start), "5")
self.assertEqual(str(location1.end), "(10.13)")
self.assertEqual(str(location2), "[<15:(20^24)]")
self.assertEqual(str(location2.start), "<15")
self.assertEqual(str(location2.end), "(20^24)")
self.assertEqual(str(location3), "[(10.13):>40]")
self.assertEqual(str(location3.start), "(10.13)")
self.assertEqual(str(location3.end), ">40")
# --- test non-fuzzy representations
self.assertEqual(int(location1.start), 5)
self.assertEqual(int(location1.end), 13)
self.assertEqual(int(location2.start), 15)
self.assertEqual(int(location2.end), 24)
self.assertEqual(int(location3.start), 10)
self.assertEqual(int(location3.end), 40)
class TestPositions(unittest.TestCase):
def test_pickle(self):
"""Test pickle behaviour of position instances."""
# setup
import pickle
within_pos = WithinPosition(10, left=10, right=13)
between_pos = BetweenPosition(24, left=20, right=24)
oneof_pos = OneOfPosition(1888, [ExactPosition(1888), ExactPosition(1901)])
# test __getnewargs__
self.assertEqual(within_pos.__getnewargs__(), (10, 10, 13))
self.assertEqual(between_pos.__getnewargs__(), (24, 20, 24))
self.assertEqual(
oneof_pos.__getnewargs__(),
(1888, [ExactPosition(1888), ExactPosition(1901)]),
)
# test pickle behaviour
within_pos2 = pickle.loads(pickle.dumps(within_pos))
between_pos2 = pickle.loads(pickle.dumps(between_pos))
oneof_pos2 = pickle.loads(pickle.dumps(oneof_pos))
self.assertEqual(within_pos, within_pos2)
self.assertEqual(between_pos, between_pos2)
self.assertEqual(oneof_pos, oneof_pos2)
self.assertEqual(within_pos._left, within_pos2._left)
self.assertEqual(within_pos._right, within_pos2._right)
self.assertEqual(between_pos._left, between_pos2._left)
self.assertEqual(between_pos._right, between_pos2._right)
self.assertEqual(oneof_pos.position_choices, oneof_pos2.position_choices)
class TestExtract(unittest.TestCase):
def test_reference_in_location_record(self):
"""Test location with reference to another record."""
parent_record = SeqRecord.SeqRecord(seq=Seq.Seq("actg"))
another_record = SeqRecord.SeqRecord(seq=Seq.Seq("gtcagctac"))
location = SimpleLocation(5, 8, ref="ANOTHER.7")
with self.assertRaisesRegex(
ValueError,
r"Feature references another sequence \(ANOTHER\.7\), references mandatory",
):
location.extract(parent_record)
with self.assertRaisesRegex(
ValueError,
r"Feature references another sequence \(ANOTHER\.7\), not found in references",
):
location.extract(parent_record, references={"SOMEOTHER.2": another_record})
record = location.extract(
parent_record, references={"ANOTHER.7": another_record}
)
self.assertEqual(type(record), SeqRecord.SeqRecord)
self.assertEqual(record.seq, "cta")
def test_reference_in_location_sequence(self):
"""Test location with reference to another sequence."""
parent_sequence = Seq.Seq("actg")
another_sequence = Seq.Seq("gtcagctac")
location = SimpleLocation(5, 8, ref="ANOTHER.7")
sequence = location.extract(
parent_sequence, references={"ANOTHER.7": another_sequence}
)
self.assertEqual(type(sequence), Seq.Seq)
self.assertEqual(sequence, "cta")
def test_reference_in_compound_location_record(self):
"""Test compound location with reference to another record."""
parent_record = SeqRecord.SeqRecord(Seq.Seq("aaccaaccaaccaaccaa"))
another_record = SeqRecord.SeqRecord(Seq.Seq("ttggttggttggttggtt"))
location = SimpleLocation(2, 6) + SimpleLocation(5, 8, ref="ANOTHER.7")
with self.assertRaisesRegex(
ValueError,
r"Feature references another sequence \(ANOTHER\.7\), references mandatory",
):
location.extract(parent_record)
with self.assertRaisesRegex(
ValueError,
r"Feature references another sequence \(ANOTHER\.7\), not found in references",
):
location.extract(parent_record, references={"SOMEOTHER.2": another_record})
record = location.extract(
parent_record, references={"ANOTHER.7": another_record}
)
self.assertEqual(type(record), SeqRecord.SeqRecord)
self.assertEqual(record.seq, "ccaatgg")
def test_reference_in_compound_location_sequence(self):
"""Test compound location with reference to another sequence."""
parent_sequence = Seq.Seq("aaccaaccaaccaaccaa")
another_sequence = Seq.Seq("ttggttggttggttggtt")
location = SimpleLocation(2, 6) + SimpleLocation(5, 8, ref="ANOTHER.7")
sequence = location.extract(
parent_sequence, references={"ANOTHER.7": another_sequence}
)
self.assertEqual(type(sequence), Seq.Seq)
self.assertEqual(sequence, "ccaatgg")
if __name__ == "__main__":
runner = unittest.TextTestRunner(verbosity=2)
unittest.main(testRunner=runner)
|