1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
|
.. _denoiser_preprocess:
.. index:: denoiser_preprocess.py
*denoiser_preprocess.py* -- Run phase of denoiser algorithm: prefix clustering
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
**Description:**
The script `denoiser_preprocess.py <./denoiser_preprocess.html>`_ runs the first clustering phase
which groups reads based on common prefixes.
**Usage:** :file:`denoiser_preprocess.py [options]`
**Input Arguments:**
.. note::
**[REQUIRED]**
-i, `-`-input_file
Path to flowgram file [REQUIRED]
**[OPTIONAL]**
-f, `-`-fasta_file
Path to fasta input file [default: None]
-s, `-`-squeeze
Use run-length encoding for prefix filtering [default: False]
-l, `-`-log_file
Path to log file [default: preprocess.log]
-p, `-`-primer
Primer sequence used for the amplification [default: CATGCTGCCTCCCGTAGGAGT]
-o, `-`-output_dir
Path to output directory [default: /tmp/]
**Output:**
prefix_dereplicated.sff.txt: human readable sff file containing the flowgram of the
cluster representative of each cluster.
prefix_dereplicated.fasta: Fasta file containing the cluster representative of each cluster.
prefix_mapping.txt: This file contains the actual clusters. The cluster centroid is given first,
the cluster members follw after the ':'.
Run program on flowgrams in 454Reads.sff. Remove reads which are not in split_lib_filtered_seqs.fasta.
Remove primer CATGCTGCCTCCCGTAGGAGT from reads before running phase I
::
denoiser_preprocess.py -i 454Reads.sff.txt -f split_lib_filtered_seqs.fasta -p CATGCTGCCTCCCGTAGGAGT
|