1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
|
\name{SiteSet}
\Rdversion{1.1}
\docType{class}
\alias{SiteSet}
\alias{SiteSet-class}
\alias{[,SiteSet-method}
\alias{[,SiteSet,ANY,ANY-method}
\alias{[,SiteSet,ANY,ANY,ANY-method}
\alias{c-methods}
\alias{c,SiteSet-method}
\alias{length,SiteSet-method}
\alias{pattern,SiteSet-method}
\alias{primary,SiteSet-method}
\alias{relScore}
\alias{relScore,SiteSet-method}
\alias{as.data.frame,SiteSet-method}
\alias{score,SiteSet-method}
\alias{seqname,SiteSet-method}
\alias{show,SiteSet-method}
\alias{sitesource,SiteSet-method}
\alias{strand,SiteSet-method}
\alias{views}
\alias{views,SiteSet-method}
\alias{start,SiteSet-method}
\alias{end,SiteSet-method}
\alias{pvalues}
\alias{pvalues,SiteSet-method}
\title{Class \code{"SiteSet"}}
\description{
The SiteSet object is a container for storing a set of putative
transcription factor binding sites on a nucleotide sequence
(start, end, strand, score, pattern as a PWMatrix, etc.)
}
\usage{
## Constructors:
SiteSet(views, score, strand="*", seqname="Unknown", sitesource="TFBS",
primary="TF binding site", pattern)
}
\arguments{
\item{views}{Object of class \code{"XStringViews"}:
It holds the start, end and the nucleotide sequence information
of the transcription factor binding sites.}
\item{score}{Object of class \code{"numeric"}:
A vector of PWM score for each putative binding site based on
the PWM matrix..}
\item{strand}{Object of class \code{"character"}:
The binding site is from the positive ("+"), negative ("-") or
unknown("*") strand.}
\item{seqname}{Object of class \code{"character"}:
The seqname of the sequence which contains these binding sites.}
\item{sitesource}{Object of class \code{"character"}:
Currently it is set to "TFBS"}
\item{primary}{Object of class \code{"character"}:
Currently it is set to "TF binding site"}
\item{pattern}{Object of class \code{"PWMatrix"}:
The PWMatrix object which is used to search the binding sites.}
}
\section{Methods}{
\describe{
\item{[}{\code{signature(x = "SiteSet")}: Getter function.}
\item{length}{\code{signature(x = "SiteSet")}:
The number of binding sites in this SiteSet.}
\item{pattern}{\code{signature(x = "SiteSet")}: Returns the PWMatrix used.}
\item{relScore}{\code{signature(x = "SiteSet")}:
Gets relative score (between 0.0 to 1.0) with respect of the score
range of the associated pattern (PWMatrix).}
\item{score}{\code{signature(x = "SiteSet")}:
Returns the score of each site.}
\item{seqname}{\code{signature(x = "SiteSet")}:
Returns the sequence name of the sequence which contains these sites.}
\item{strand}{\code{signature(x = "SiteSet")}:
Returns the strand information.}
\item{views}{\code{signature(x = "SiteSet")}: Returns the views object.}
\item{start}{\code{signature(x = "SiteSet")}:
Returns the start coordinates.}
\item{end}{\code{signature(x = "SiteSet")}: Returns the end coordinates.}
\item{pvalues}{\code{signature(x = "SiteSet")}
(x, type=c("TFMPvalue", "sampling")):
Calculates the empirical p-values for the scores with two methods:
the exact method from TFMPaluve package or
implementation of sampling in this package.
The background probability for sampling is based on
the PWM matrix in the \code{SiteSet} object.
}
}
}
\details{
The score retuned in SiteSet is the absolute score of each putative TFBS
scanned by the corresponding PWM.
The way of calculating the score is shown on the refernce, Page 281.
}
\references{
Wasserman, W. W., & Sandelin, A. (2004). Applied bioinformatics for the identification of regulatory elements. Nature Publishing Group, 5(4), 276-287. doi:10.1038/nrg1315
}
\author{
Ge Tan
}
\seealso{
\code{\link{searchSeq}},
\code{\link{searchAln}},
\code{\linkS4class{PWMatrix}},
\code{\linkS4class{SiteSetList}},
\code{\linkS4class{SitePairSet}}
}
\examples{
data(MA0003.2)
pwm <- toPWM(MA0003.2)
siteset <- searchSeq(pwm, "GAATTCTCTCTTGTTGTAGTCTCTTGACAAAATG",
min.score="60\%")
writeGFF3(siteset, scoreType="absolute")
as(siteset, "data.frame")
as(siteset, "DataFrame")
as(siteset, "GRanges")
relScore(siteset)
pvalues(siteset, type="TFMPvalue")
pvalues(siteset, type="sampling")
}
\keyword{classes}
|